Probiotic white cheese production using coculture with Lactobacillus species isolated from traditional cheeses

Research (Published online: 30-05-2018)

23. Probiotic white cheese production using coculture with Lactobacillus species isolated from traditional cheeses

A. Ehsani, M. Hashemi, A. Afshari and M. Aminzare

Veterinary World, 11(5): 726-730

ABSTRACT

Aim: The aim of the present study was to investigate the viability of lactic acid bacteria isolated from traditional cheeses and cocultured in Iranian white cheese during ripening.

Materials and Methods: A total of 24 samples were isolated from 8 types of traditional cheeses in West Azerbaijan, Iran. Isolated species were cocultured with starter bacteria during the production of Iranian white cheese, and their viability was investigated up to 60 days of the refrigerated storage.

Results: Of 118 isolates of Lactobacillus, 73 isolates (62%) were confirmed as facultative heterofermentative and 45 isolates (38%) as obligate homofermentative. Of the facultative heterofermentatives, 28 isolates (24%) were Lactobacillus plantarum, 24 isolates (20%) were Lactobacillus casei, and 21 isolates (18%) were Lactobacillus agilis. Obligate homofermentatives were Lactobacillus delbrueckii (21%), Lactobacillus helveticus (14%), and Lactobacillus salivarius (3%). L. plantarum, L. casei and L. helveticus were found in high enough levels (106 CFU/g).

Conclusion: According to the obtained data, it is recommended that complex starters such as L. helveticus, L. plantarum, and L. casei can be used in industrial productions of cheese to obtain exclusive properties of traditional cheeses.

Keywords: heterofermentative, Lactobacillus, probiotic, starter, traditional cheeses.

The improvement of eggs quality of Mojosari duck (Anas javanica) with soybean husk fermentation using cellulolytic bacteria of Spodoptera litura

Research (Published online: 29-05-2018)

22. The improvement of eggs quality of Mojosari duck (Anas javanica) with soybean husk fermentation using cellulolytic bacteria of Spodoptera litura

Sri Hidanah, Dady Soegianto Nazar and Erma Safitri

Veterinary World, 11(5): 720-725

ABSTRACT

Aim: This study was aimed to improve the quality of the eggs of Mojosari duck (Anas javanica) through complete feeding containing soybean husk was fermented using cellulolytic bacteria of Spodoptera litura.

Materials and Methods: This study consisted of three stages: The first stages, isolation and identification of cellulolytic bacteria from S. litura; the second stage, the fermentation of soybean husk through the application of bacterial cellulolytic isolate from the first stage; and the third stage, the application of the best complete feed formulation from the second stage to Mojosari duck.

Results: There are four dominant bacteria: Bacillus sp., Cellulomonas sp., Pseudomonas sp., and Cytophaga sp. Furthermore, the best reduction of the crude fiber of soybean husks is the use of Cellulomonas sp. bacteria. The final of the study, the quality of the eggs of Anas javanica, was improved, as indicated by cholesterol decrease from the yolk without the decrease of egg weight and eggshell thickness, although the decrease in egg yolk color was inevitable.

Conclusion: Soy husk fermentation using cellulolytic bacteria of S. litura was added to complete feeding can be performed to improve the quality of the eggs of Mojosari duck.

Keywords: cellulolytic bacteria, eggs quality of duck, soybean husk fermentation, Spodoptera litura.

Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period

Research (Published online: 28-05-2018)

21. Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period

A. Allaoui, B. Safsaf, M. Tlidjane, I. Djaalab and H. Djaalab Mansour

Veterinary World, 11(5): 712-719

ABSTRACT

Aim: The aim of the study was to assess the effect of two levels of wasted date (WD) by replacing commercial concentrate on the reproductive performance of Ouled Djellal (OD) rams.

Materials and Methods: Eighteen mature (2-year-old) OD rams were equally allocated to three groups and fed during 11 weeks with one of three different experimental diets, that contained 0% (0 WD), 50% (50 WD), or 75% (75 WD) of WDs in concentrate diet. Live body weight (LBW), body condition scoring (BCS), scrotal circumference (SC), testicular weight (TW), sperm production and quality, plasma testosterone concentration (T), and sexual behavior (reaction time and number of mounts with ejaculation) were regularly recorded from every ram.

Results: LBW, SC, and TW changed significantly among diet groups and during the experimental period (p<0.001), the highest averages were recorded in (0 WD) group. LBW, BCS, SC, TW, semen volume, and percentage of the positive hypo-osmotic swelling test were (p<0.001) positively influenced by flushing period. Nevertheless, sperm concentration showed a significant (p<0.001) decrease at day 30, followed by a return to the initial values afterward. There were no differences (p>0.05) between diet groups for plasma testosterone concentration and semen attributes, except that (50 WD) group expressed the lowest overall value of semen concentration. Furthermore, neither time nor diet affected (p>0.05) sperm motility and reproductive behavior parameters.

Conclusion: It is possible to introduce WD as unconventional local feeding resources in flushing diet of breeding rams without disturbing their reproductive performance.

Keywords: body weight, flushing period, rams, semen, wasted date.

The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm

Research (Published online: 27-05-2018)

20. The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm

Tippawan Jantafong, Sakchai Ruenphet, Darsaniya Punyadarsaniya and Kazuaki Takehara

Veterinary World, 11(5): 706-711

ABSTRACT

Aim: The aim of this study was to determine the effectiveness of the fourth-generation quaternary ammonium compounds, didecyl dimethyl ammonium bromide (DDAB), on the efficacy of bacterial and viral decontamination against pathogens commonly found in livestock industry including Salmonella infantis (SI), Escherichia coli, and avian influenza virus (AIV).

Materials and Methods: The DDAB was prepared at 500, 250, and 125 parts per million (ppm) for absent and present organic material. Meanwhile, 5% of fetal bovine serum in DDAB solution sample was used to mimic the presence of organic material contamination. 400 μl of each DDAB concentration was mixed with 100 μl of each pathogen (SI, E. coli, and AIV) and then incubated at room temperature or 4°C at various time points (5 s, 30 s, 1 min, 5 min, 10 min, 15 min, and 30 min). The activity of DDAB treatment was stopped using 500 μl of FBS. Each treatment sample was titrated on either deoxycholate hydrogen sulfide lactose agar plates or Madin-Darby canine kidney cells for bacteria and AIV, respectively. Each treatment was conducted in triplicates, and the pathogen inactivation was considered effective when the reduction factor was ≥ 3 log10.

Results: Our current study revealed that the DDAB inactivated SI, E. coli, and AIV under the various concentrations of DDAB, organic material conditions, exposure temperature, and exposure timing. In addition, the comparison of bactericidal and virucidal efficacy indicated that bacteria were more susceptible to be inactivated by DDAB as compared to viruses. However, DDAB showed marked inactivated differences in the absence or presence of organic materials.

Conclusion: The DDAB may be a potential disinfectant for inactivating bacteria and viruses, especially enveloped viruses, in livestock farms. It can be useful as a disinfectant for biosecurity enhancement on and around animal farm.

Keywords: bactericidal, didecyl dimethyl ammonium bromide, disinfectant, quaternary ammonium compound, virucidal.

Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran

Research (Published online: 26-05-2018)

19. Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran

Hadi Mirahmadi, Nasrin Rezaee, Ahmad Mehravaran, Peyman Heydarian and Saber Raeghi

Veterinary World, 11(5): 700-705

ABSTRACT

Aim: Cutaneous leishmaniasis (CL) is one of the most important health problems that are capable of involving both tropical and subtropical areas, especially in Iran. This cross-sectional study aimed to differentiate the species that are able to cause CL in Zahedan city by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.

Materials and Methods: It was conducted on 145 suspected CL patients in Zahedan city between 2014 and 2016. The smears were initially prepared, air-dried, fixed with absolute methanol, and stained with 10% Giemsa. Then, we examined the stained samples by a light microscope under 1000× magnifications. PCR assay targeted cytochrome b (cyt b) gene using LCBF1 and LCBR2 primers and the products digested by Ssp1 enzymes.

Results: From 145 suspected CL patients, 76 (52.4%) were positive in microscopic examination. In addition, we detected gene of interest (cyt b) in 98 (67.5%). The results of PCR-RFLP indicated that 53/98 (54%) cases were Leishmania major and 45/98 (46%) were Leishmania tropica, and the main species in these areas was L. major.

Conclusion: We concluded that the microscopic examination is not sensitive enough and is not able to distinguish between different Leishmania species. Instead, molecular methods like PCR-RFLP can be appropriately used with promising results.

Keywords: cytochrome b, Leishmania major, Leishmania tropica, polymerase chain reaction-restriction fragment length polymorphism.

Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Research (Published online: 25-05-2018)

18. Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Foukpe Zhairath Adambi Boukari, Ibrahim Traore Alkoiret, Soumanou Seibou Toleba, Athanase Ahissou, Fataou Zacharie Toure, Aliyassou Mama Yacoubou, Gabriel Assouan Bonou, Ignace Ogoudanan Dotche, Victoire Akpaki and Issaka Youssao Abdou Karim

Veterinary World, 11(5): 693-699

ABSTRACT

Aim: The current study aims to evaluate the reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm.

Materials and Methods: Semen from exotic breeds was used to inseminate 70 Borgou cows on induced estrus with the norgestomet implant and 285 others on natural estrous. Data on the reproductive performances of inseminated cows were collected.

Results: In inseminated cows on induced estrus, the pregnancy rate was 30% and that of abortion was 9.52%. The fertility rate was 28.57% and those of live births and mortality were, respectively, 105.26% and 5% in these cows. As for inseminated cows on natural estrus, the pregnancy rate was 75.79% and the one of calving was 88.89%. The fertility rate recorded with natural estrous was 66.67% and was significantly higher than the one recorded with insemination on induced estrus. The live births and the birth-weaning mortality rates were, respectively, 98.96% and 11.58% in inseminated cows on natural estrus.

Conclusion: Reproductive performances are better in Borgou cows inseminated on natural estrus than in those inseminated on induced estrus.

Keywords: artificial insemination, Benin, cattle, reproductive performances.

Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Research (Published online: 24-05-2018)

17. Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Khumaji Badaji Kataviya, Bharat Parmar, Ramesh Patel, Pranab Jyoti Das, Vivek Kumar, Amit Mahajan, Ravinder Singh, Devesh Thakur, Amol Kinhekar, R. K. Ravikumar and Vipin Kumar

Veterinary World, 11(5): 687-692

ABSTRACT

Aim: This study was conducted to demonstrate the acaricide efficacy of novel indigenous veterinary medication shared by an outstanding knowledge holder against naturally infested cattle and efforts in mainstreaming such wisdom.

Materials and Methods: An indigenous herbal medication in control of tick infestation was documented, and experimentation was held against naturally affected cattle. Eighteen clinically infested cattle population comprising 16 crossbred and 2 non-descript cattle were purposively selected. Majority of them were adult females, reported with a higher incidence of tick at Veterinary institution. The average pre-treatment tick count at 24 sites of observations among these animals was 18.91±2.04 (Mean [x̄]±standard error [SE]). The medication was topically applied once daily for 2 days and post-treatment observations were recorded for an experimental period of 14 days' duration.

Results: During 24-h post-treatment observation, the medication had shown 92.95% acaricidal property with clinically irrelevant rate of tick infestation of 1.33±0.39 (x̄±SE) was noticed before application of subsequent (second) dosage. This practice was found significantly effective at 5% level of significance (t0.05, 23=9.08) illustrating faster relief to livestock. Animals were treated with herbal medication as per dosage on the second day and no reinfestation was noticed up to 14 days of experimental observation.

Conclusion: The study strengthens the belief that indigenous herbal acaricide can facilitate quality livestock service at geographically distant locations. These medications can provide quicker relief, minimize tick resistance and are favorable to the environment.

Keywords: acaricide, indigenous, institution, livestock, ruminant, tick.

Cryptosporidiosis: A zoonotic disease concern

Review (Published online: 23-05-2018)

16. Cryptosporidiosis: A zoonotic disease concern

Natapol Pumipuntu and Supawadee Piratae

Veterinary World, 11(5): 681-686

ABSTRACT

Cryptosporidiosis is considered to be a crucial zoonotic disease caused by worldwide distributing parasitic protozoa called Cryptosporidium spp. Cryptosporidiosis becomes a major public health and veterinary concern by affecting in human and various host range species of animals. Essentially, its importance of infection is increasing because of the high incidence in young children, immunocompromised persons, or immunodeficiency syndrome patients, especially in HIV/AIDS, and it is also one of the most causes of mortality in those patients who infected with Cryptosporidium spp. as well as young animals. All domestic animal, livestock, wildlife, and human can be potential reservoirs that contribute Cryptosporidium spp. to food and surface waters and transmitted to other hosts through fecal-oral route. The oocyst stage of Cryptosporidiumspp. can remain infective and resistant to various environmental exposure and also resistant to many general disinfecting agents including chlorination which normally used in water treatment. Therefore, the understanding of these zoonotic pathogens is very essential in both animal and human health. This review focuses on the biology, life cycle, transmission, diagnosis, treatment, prevention, and control of this protozoan infection to emphasize and remind as the significant One Health problem.

Keywords: cryptosporidiosis, diarrhea, waterborne disease, zoonosis.

Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

Research (Published online: 22-05-2018)

15. Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

K. T. Biobaku, T. O. Omobowale, Ahmed O. Akeem, A. Aremu, N. Okwelum and A. S. Adah

Veterinary World, 11(5): 674-680

ABSTRACT

Aim: The study determined the effect of ascorbic acid (administered orally and intramuscularly) in short-term transportation stress.

Materials and Methods: Twenty-four apparently healthy Kalahari goats were grouped into four groups (A, B, C, and D) of 6 animals each: Group A - untreated and unexposed to stress; Group B - treated with 200 mg/kg Vitamin C orally and exposed to 2 h transportation stress; Group C - treated with Vitamin C 200 mg/kg intramuscularly and exposed to 2 h transportation stress; and Group D - untreated and exposed to 2 h transportation stress. The animals were stocked using standards stipulated by the Nigerian Animal Disease Control Act and transported at 40 km/h. Cortisol and interleukin-6 (IL-6) were assayed using quantitative sandwich ELISA. Classical stress hematological parameters and antioxidative stress markers such as glutathione s-transferase, superoxide dismutase, and malondialdehyde were determined. Heart rate variability (HRV) was also assessed.

Results: The route of ascorbic acid administration did not influence the expression of IL-6, and changes in cortisol surge, antioxidative stress markers, and other hematological parameters in Kalahari goats though Group C goats showed higher HRV values (p<0.05) than others. This gives credence to the enhanced cardiac responsiveness and stress survivability in Kalahari goats.

Conclusion: Both routes could be used in the administration of ascorbic acid. Kalahari goats exposed to short-term stress; however, the intramuscular route had better heart variability and thus improved the survivability of the animals.

Keywords: ascorbic acid, intramuscular, oral, Kalahari goats, stress.

Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

Research (Published online: 21-05-2018)

14. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

S. R. Eman, A. A. Kubesy, T. A. Baraka, F. A. Torad, I. S. Shaymaa and Faten F. Mohammed

Veterinary World, 11(5): 667-673

ABSTRACT

Aim: This study was performed to evaluate the diagnostic value of hepatocyte-derived microRNA (miRNA)-122 in acute and chronic hepatitis of dogs.

Materials and Methods: A total of 26 dogs presented at Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Cairo University, 16 dogs out of 26 showing clinical signs of hepatic insufficiency were subjected to clinical, ultrasonographic, hematobiochemical and ultrasound-guided fine-needle biopsy for cytological and histopathological investigations. On the basis of these results, 7 dogs out of 16 dogs were found to be suffering from acute hepatitis and 9 dogs suffering from chronic hepatitis. 10 clinically healthy dogs were kept as control. Serum hepatocyte-derived miRNA-122 was analyzed by real-time quantitative polymerase chain reaction in all dogs.

Results: The dogs suffering from acute hepatitis manifested jaundice, vomiting, and depression while dogs with chronic hepatitis manifested anorexia, abdominal distension, weight loss, and melena. Hematological parameters showed normocytic normochromic anemia and thrombocytopenia in both acute and chronic hepatitis groups. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total bilirubin were significantly higher than control values in acute hepatitis. In chronic hepatitis, total protein and albumin were significantly lower than control values with normal ALT, AST, ALP, and gamma-glutamyltransferase values. Ultrasonography revealed a diffuse decrease in hepatic echogenicity in acute hepatitis while the increase in hepatic echogenicity and anechoic ascetic fluid in chronic hepatitis. Cytology revealed hepatic vacuolar degeneration and histopathology revealed necrosis and apoptosis of hepatocyte in acute hepatitis while revealed massive fibrous tissue proliferation in hepatic parenchyma in chronic hepatitis. Serum miRNA-122 analysis, normalized for glyceraldehyde-3- phosphate dehydrogenase expression revealed a significant increase in acute hepatitis accompanied with elevation in ALT and AST, while in chronic hepatitis, elevation of serum miRNA-122 was accompanied with ALT and AST of the normal range.

Conclusion: Serum hepatocyte-derived miRNA-122 is of diagnostic value and highly stable blood indicator for the detection of hepatocellular injury in dogs than aminotransferases, especially in cases where aminotransferases do not exceed normal serum level.

Keywords: canine, cytology and histopathology, hepatitis, hepatocyte derived miRNA-122, ultrasonography.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)

13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti

Veterinary World, 11(5): 657-666

ABSTRACT

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)

12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior

Veterinary World, 11(5): 649-656

ABSTRACT

Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.

Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.

Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.

Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.

Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.

Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Research (Published online: 18-05-2018)

11. Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Suppada Kananub, Wassana Jawjaroensri, John VanLeeuwen, Henrik Stryhn and Pipat Arunvipas

Veterinary World, 11(5): 642-648

ABSTRACT

Aim: The study was to determine seasonal fluctuations and non-nutritional factors associated with bulk tank milk urea nitrogen (BTMUN).

Materials and Methods: A total of 58,364 BTM testing records were collected from 2364 farms in Central Thailand during September 2014-August 2015. Using square root BTMUN as the outcome, other milk components, farm effect, and sampling time were analyzed by univariable repeated measures linear regression, and significant variables were included in multivariable repeated measures linear regression.

Results: The average BTMUN (standard deviation) was 4.71 (±1.16) mmol/L. In the final model, BTM fat and protein percentages were associated with BTMUN as quadratic and cubic polynomials, respectively. BTM lactose percentage and the natural logarithm of somatic cell counts were negatively linearly associated with BTMUN. At the farm level, the BTM lactose association was negatively linear; herd BTMUN decreased following an increase of herd lactose average, and BTM lactose slopes were quite different among farms as well. Sampling time had the highest potency for the estimation of BTMUN over time, with lows and highs occurring in August and October, respectively. The variation in test level BTMUN was decreased by 18.6% compared to the null model, and 6% of the variance could be explained at the farm level.

Conclusion: The results clarify seasonal variation in BTMUN and the relationships among other BTM constituents and BTMUN, which may be useful for understanding how to manage lactating dairy cattle better to keep BTM constituents within normal ranges.

Keywords: bulk tank milk urea nitrogen, farm level, non-nutritional factor, Thailand.

Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Research (Published online: 17-05-2018)

10. Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Mohammad Tabatabaei and Fatemeh Abdollahi

Veterinary World, 11(5): 636-641

ABSTRACT

Background and Aim: Mannheimia haemolytica is a Gram-negative, non-motile, and non-spore-forming rod-shaped coccobacillus bacterium. On blood agar plate, it shows complete hemolysis. This bacterium constitutes a part of normal flora of the upper respiratory system of ruminants. It is considered as the opportunistic pathogen and the main factor of pneumonic pasteurellosis, which has caused a severe economic loss in sheep and cattle industries. Considering the prevalence of the disease in sheep and goat population in the dry and hot regions of the country in general and in Fars province in particular in the form of pneumonia, the purpose of this study was to isolate and identify the bacterium M. haemolytica from the lung tissues of sheep slaughtered in Shiraz abattoir through culturing and polymerase chain reaction (PCR) methods.

Materials and Methods: In this study, a total of 2500 sheep's lungs were evaluated for finding pneumonic effects. Then, 161 infected pneumonic samples of lung tissues were investigated by culture and PCR methods.

Results: After cultivation, purification, and DNA extraction, 38 samples were found positive for M. haemolytica by cultivation and then all the 38 isolates were confirmed by PCR and multiplex PCR (mPCR). Results of this study indicated that culture and PCR are both practical in identification and isolation of this bacterium though culture is more time-consuming. The utilized mPCR has been more successful in the identification of the bacteria since it requires less time and cost.

Conclusion: In this study, PCR as a superior method among other methods of bacteriology for fast examination of infectious diseases and mPCR, which is a valuable tool for identification of M. haemolytica in clinical samples of animals, was used.

Keywords: Mannheimia haemolytica, pneumonia, polymerase chain reaction, sheep, Shiraz.

The crucial roles of inflammatory mediators in inflammation: A review

Review (Published online: 15-05-2018)

9. The crucial roles of inflammatory mediators in inflammation: A review

L. A. Abdulkhaleq, M. A. Assi, Rasedee Abdullah, M. Zamri-Saad, Y. H. Taufiq-Yap, and M. N. M. Hezmee

Veterinary World, 11(5): 627-635

ABSTRACT

The inflammatory response is a crucial aspect of the tissues' responses to deleterious inflammogens. This complex response involves leukocytes cells such as macrophages, neutrophils, and lymphocytes, also known as inflammatory cells. In response to the inflammatory process, these cells release specialized substances which include vasoactive amines and peptides, eicosanoids, proinflammatory cytokines, and acute-phase proteins, which mediate the inflammatory process by preventing further tissue damage and ultimately resulting in healing and restoration of tissue function. This review discusses the role of the inflammatory cells as well as their by-products in the mediation of inflammatory process. A brief insight into the role of natural anti-inflammatory agents is also discussed. The significance of this study is to explore further and understand the potential mechanism of inflammatory processes to take full advantage of vast and advanced anti-inflammatory therapies. This review aimed to reemphasize the importance on the knowledge of inflammatory processes with the addition of newest and current issues pertaining to this phenomenon.

Keywords: chemokines, cytokines, inflammatory mediators, inflammatory response.

Evaluation of wet cupping therapy on the arterial and venous blood parameters in healthy Arabian horses

Research (Published online: 14-05-2018)

8. Evaluation of wet cupping therapy on the arterial and venous blood parameters in healthy Arabian horses

Turke Shawaf, Wael El-Deeb, Jamal Hussen, Mahmoud Hendi and Shahab Al-Bulushi

Veterinary World, 11(5): 620-626

ABSTRACT

Aim: Recently, the complementary therapies such as cupping and acupuncture are being used in veterinary medicine. This research was carried out to determine the effects of wet cupping therapy (Hijama) on the hematological and the biochemical parameters in the healthy Arabian horses for the first time.

Materials and Methods: In this study, seven clinically healthy Arabian horses were randomly selected. Four points on the animal body were selected to perform the cupping therapy. Two points were selected at the back just behind the scapula on the left and right sides; another two points were located in the rump. Cups with 4 oz (125 ml) size with narrow mouths were used. A manual pump (sucking cups) was used to create the negative pressure within the cups during cupping. Arterial and venous blood parameters and serum cortisol concentration were measured before cupping and 3 days and 2, 4, and 8 weeks after cupping.

Results: No significant differences were estimated in most hematological and biochemical parameters after cupping. A significant decrease in the concentration of serum cortisol was observed in 3 and 14 days after cupping.

Conclusion: Cupping induced minor changes on the hematological and biochemical parameters in Arabian horses. This is the first trial on the effects of wet cupping therapy on the different parameters in Arabian horses, which would be useful for further investigations on the role of complementary therapies in horses. Our further studies will include different disease models.

Keywords: biochemical, cortisol, cupping, hematological, horse.

Assessment of the peste des petits ruminants world epizootic situation and estimate its spreading to Russia

Research (Published online: 13-05-2018)

7. Assessment of the peste des petits ruminants world epizootic situation and estimate its spreading to Russia

Fayssal Bouchemla, Valerey Alexandrovich Agoltsov, Olga Mikhailovna Popova and Larisa Pavlovna Padilo

Veterinary World, 11(5): 612-619

ABSTRACT

Aim: This study focuses on the spatial dynamic associated with the spreading of the peste des petits ruminants (PPR) disease for the past decade (from the year 2007 to 2017), assesses the resulting situation in the world, and has an emphasis on Russian advantages been a PPR host.

Materials and Methods: Outbreaks were confirmed and reported officially by the World Organization for Animal Health (enzyme-linked immunosorbent assay and polymerase chain reaction were used). Data contain the account number of infected, dead, and all susceptible animals in focus of infection in the period of 2007-2017. Once conventional statistical population was defined, a model was installed. Geo-information system QuickMAP was used to clear up the map disease, and through the @Risk program, we got our forecasting value of future situations (by Monte Carlo method).

Results: The spatial study of PPR's occurrence and its spread was mapping according to the incidence of cases and outbreaks. Clusters demonstrated risk levels in the world in the period from 2007 to 2017 year. Based on the epizootological analysis, an assessment of PPR risk and the probability movement of infection in Russia from nearby disadvantaged countries had been carried out. A statistically significant impact of the socioeconomic system on the stationarity index was found equal to 0.63. The PPR risk of spreading could not be ignored. Nevertheless, conducting effective large-scale vaccine companies in a complex of antiepizootic activities against PPR could reduce the risk of spread of the disease up to 91.8%.

Conclusion: Despite all mentioned facts above, the PPR probability can only be reduced by coordinating work of border veterinary services, as in disadvantaged as in free from this disease country, that is, what makes an effective and complete eradication of the disease could be quite realistic.

Keywords: forecast, incidence, outbreaks, peste des petit ruminants, risk factors.

Estimation of deltamethrin residues in cow's and goat's environment and trials to reduce its level in milk

Research (Published online: 11-05-2018)

6. Estimation of deltamethrin residues in cow's and goat's environment and trials to reduce its level in milk

Halla E. K. El Bahgy, Hend A. Elbarbary and Samar S. Ibrahim

Veterinary World, 11(5): 606-611

ABSTRACT

Aim: The present study was aimed to estimate deltamethrin residues in cow's and goat's environment over a certain period of time post-application, to identify the role of both feed and water as a source of pesticides, and to conduct some trials to reduce their levels in milk.

Materials and Methods: A total of 80 water and feed samples (40 of each) and 120 milk samples (80 cow's milk and 40 goat's milk) were collected. Fresh milk samples were collected directly from the udder as well as from feed and water before application and 1st, 2nd, 3rd, 7th, 15th, 21st, and 35th days after insecticide application.

Results: Deltamethrin residues were detected after its application in both water and feed at different levels up to the first 3 days and in all cow's and goat's milk samples at 35th day. The highest levels were detected in milk samples at the 2nd day then at the 7th day followed at the 15th day after application as such levels were above the maximum residual limits. By microwaving the polluted cow's milk samples, deltamethrin residues were not detected without influencing the chemical composition of the milk. However, on freezing of milk, the deltamethrin residues reached 12.6±3.24 μg/L in association with a significant decline in the concentration of fat.

Conclusion: Microwaving of milk is an effective method to decline deltamethrin concentration in milk.

Keywords: deltamethrin, freezing, high-performance liquid chromatography, microwaving treatment, milk, pesticides residues.

A retrospective study of bovine tuberculosis at the municipal abattoir of Bauchi State, Northeastern Nigeria

Research (Published online: 10-05-2018)

5. A retrospective study of bovine tuberculosis at the municipal abattoir of Bauchi State, Northeastern Nigeria

Saleh Mohammed Jajere, Naphtali Nayamanda Atsanda, Asinamai Athliamai Bitrus, Tasiu Mallam Hamisu and Mohammed Dauda Goni

Veterinary World, 11(5): 598-605

Background and Aim: Bovine tuberculosis (bTB) still remains a major zoonotic bacterial disease affecting livestock and humans worldwide. The disease remains a poorly managed tropical disease in most developing countries of the world; where in addition to productivity losses and significance in international trade, it posed a major public health threat to both humans and animals. A retrospective study was designed to investigate the occurrence of bTB lesions at Bauchi municipal abattoir.

Materials and Methods: The study utilized abattoir records spanning a period of 10 years (2004-2013). The records indicated that a total of 1,08,638 heads of cattle comprising n = 56,070 males and n = 52,570 females were slaughtered at the municipal abattoir during the study period.

Results: Of these heads, n = 1230 (1.13%) (95% confidence interval [CI]: 1.07, 1.19) had tuberculous lesions. The annual occurrence during the study period varied significantly (p<0.001) from 0.53% (95% CI: 0.40, 0.67) to 1.87% (95% CI: 1.66, 2.10) in 2010 and 2012, respectively. Females had a significantly higher (p<0.001) prevalence of 2.10% (95% CI: 1.98, 2.23) compared with the males 0.23% (95% CI: 0.19, 0.27). The distribution of suspected gross bTB lesions in different organs showed 11.87% in the lungs, 5.93% in the liver, 1.14% in the heart, and 0.49% accounted for generalized bTB. However, none was observed on the lymph nodes and intestines.

Conclusion: It can be concluded that bTB persists in Bauchi State with annual variations during the study period. This study highlights the importance of meat inspection as an important tool for detecting the presence of bTB lesions.

Keywords: Bauchi, bovine tuberculosis, Mycobacterium bovis, prevalence, retrospective.

Effect of the essential oil of Rosmarinus officinalis (L.) on rooster sperm motility during 4°C short-term storage

Research (Published online: 09-05-2018)

4. Effect of the essential oil of Rosmarinus officinalis (L.) on rooster sperm motility during 4°C short-term storage

L. Touazi, B. Aberkane, Y. Bellik, N. Moula and M. Iguer-Ouada

Veterinary World, 11(5): 590-597

Aim: This study aimed to investigate the protective effect of Rosmarinus officinalis (L.) essential oil on rooster sperm motility during 4°C short-term storage.

Materials and Methods: R. officinalis essential oil was analyzed using gas chromatography coupled to mass spectrometry to identify the active components. 10 of 45-week-old Hubbard commercial broilers were subjected to biweekly semen collections during 3 weeks. At each collection, sperm was pooled and divided into four aliquots and then diluted with Tris extender supplemented with 870, 87, or 8.7 μg/ml of R. officinalisessential oil, identified as treatments R, R5, and R10, respectively. Tris-based extender without any supplementation was considered as a control group. Diluted sperm was then stored at 4°C in the refrigerator and analyzed at 0, 6, 24, and 48 h using a computer-assisted sperm analyzer. Different semen parameters were measured including total motility, progressive motility, gametes velocities (straight line velocity [VSL], curvilinear velocity [VCL], and average path velocity [VAP]), amplitude of the lateral head displacement [ALH], and beat-cross frequency [BCF].

Results: The phytochemical analysis of R. officinalis essential oil revealed the presence of 25 active components including seven major molecules: Camphor (18.88%), camphene (5.17%), 1,8-cineole (7.85%), β-thujene (13.66%), α-thujene (4.87%), chrysanthenone (12.05%), and β-cubenene (7.97%). The results showed a beneficial effect of R. officinalis essential oil on sperm cells motility, particularly when using the lowest concentrations, 8.7 and 87 μg/ml. Progressive motility and gametes velocities (VCL, VSL, and VAP), materializing the quality of gametes motility, showed highly statistically significant values (p<0.01) in 8.7 and 87 μg/ml treatments, especially from 6 h of storage at 4°C. Conversely, the highest concentration (870 μg/ml) showed harmful effects with a total spermicidal activity after 24 h of storage.

Conclusion: The current results revealed the positive impact of R. officinalis essential oil on rooster sperm at 4°C short-term storage probably through fighting against oxidative stress and cold shock damages.

Keywords: antioxidant, avian semen, liquid storage, rosemary essential oil.

Prevalence of Cryptosporidium spp. oocysts in dogs in Lusaka district of Zambia

Research (Published online: 06-05-2018)

3. Prevalence of Cryptosporidium spp. oocysts in dogs in Lusaka district of Zambia

Lamson Mugala, Joyce Siwila, Ngonda Saasa and Girja Shanker Pandey

Veterinary World, 11(5): 585-589

ABSTRACT

Aim: Cryptosporidium is one of the causes of diarrheal illness in man and animals worldwide and is zoonotic. The study aimed to determine the prevalence and risk factors associated with fecal shedding of Cryptosporidium oocysts in dogs in Lusaka district of Zambia.

Materials and Methods: A cross-sectional study was conducted in Lusaka district of Zambia during 2015-2016. A total of 390 dogs (243 males and 147 females) aged 2 months-13 years were enrolled. Fecal samples were collected and stained using modified Ziehl-Neelsen and Auramine O staining techniques and examined microscopically for oocysts.

Results: Overall, the prevalence of Cryptosporidium oocysts infection was 5.9% (23/390; 95% confidence interval: 3.9-8.7). Prevalence among male dogs and female dogs was 5.3% and 6.8%, respectively. Older dogs had a relatively higher infection rate compared to the younger puppies. There was a statistically significant difference in infection between nondescript breed and pure breeds with prevalence being higher in nondescript dog breeds. Water source was also significantly associated with Cryptosporidium infection.

Conclusion: Cryptosporidium infections are common, especially among the nondescript breed of domestic dogs in Lusaka district of Zambia. Further studies to characterize the common species are warranted.

Keywords: Cryptosporidium spp., dogs, Lusaka, prevalence, Zambia.