In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines

Research (Published online: 19-05-2020)

15. In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines

Bambang Pontjo Priosoeryanto, Riski Rostantinata, Eva Harlina, Waras Nurcholis, Rachmi Ridho and Lina Noviyanti Sutardi

Veterinary World, 13(5): 931-939

ABSTRACT

Background and Aim: Tumor disorder is one of the degenerative diseases that affected human and animals and recently is tend to increase significantly. The treatment of tumor diseases can be performed through surgical, chemotherapy, radiotherapy, biological substances, and herbs medicine. Typhonium flagelliforme leaves extract known to have an antiproliferation activity, while interferons (IFNs) one of the cytokines that first used as an antiviral agent was also known to have antitumor activity. Nowadays, the treatment of tumors using a traditional way, including the use of herbal substances, becomes popular. Some limitations of the antitumor activity due to resistant development of the cell to some substances were one of the problems on why the treatment of cancer was unsuccessful. This study aimed to elaborate the synergistic effect on the antiproliferation and anti-angiogenesis activities of the combinations between T. flagelliforme leaves ethanol extract and canine natural (natural canine IFN [nCaIFN]) and recombinant (recombinant canine IFN [rCaIFN]) IFNs on tumor-derived cell lines to find the new potential antitumor substances.

Materials and Methods: The extraction of T. flagelliforme leaves was performed using the maceration method and followed by phytochemical screening assays. According to the result of LC50 by the brine shrimp lethality test, the dose used for T. flagelliforme extract was 120 ppm while the dose of IFNs was 102 U/ml. The tumor-derived cell lines (canine squamous cell carcinoma [CSCC], canine mammary gland benign mixed tumor/MCM-IPB-B3, and feline squamous cell carcinoma [FSCC]) and normal rabbit endothelial cells were cultured and maintained on Dulbecco's Modified Eagle's Medium DMEM/Ham-F12 medium supplemented with 10% fetal calf serum, antibiotic, and antifungal. The antiproliferation activity was assayed by calculated the total cell number after treated with the tested substances. The antiangiogenesis assay was performed using in vitro method on rabbit normal endothelial cells and in ovo using chicken chorioallantoic membrane (CAM).

Results: The phytochemical screening test of the T. flagelliforme leaves ethanol extract indicated that the compound consisted of flavonoid, steroid, and tannin. The antiproliferation activity was increased in the combination of substances compared to the single exposure of each substance on all tested tumor-derived cell lines. There was no significantly different on the antiproliferation activity between a combination of T. flagelliforme with nCaIFN or rCaIFN in every single tested cell lines, but the comparison of this activity among the three tumor-derived cell lines seem that the antiproliferation activity is more effective on CSCC cell lines compared to the canine mammary gland benign mixed tumor and FSCC cell lines. A similar pattern of synergistic effect was also detected on the anti-angiogenesis activity in vitro using rabbit endothelial cells as well as in ovo assays. The most effective of the in vitro and in ovo anti-angiogenesis activity was observed on the combination substances between T. flagelliforme extract and rCaIFN compared to other treatments.

Conclusion: There was a synergistic effect on the antiproliferation and antiangiogenesis activities of the combination between T. flagelliforme and canine IFNs (natural and recombinant) and this result could be developed as another alternative on the cancer treatments.

Keywords: antiproliferation, antiangiogenesis, canine interferons, ethanol extract, tumor cell lines, Typhonium flagelliforme.

Biochemical and immunological investigation of fascioliasis in cattle in Egypt

Research (Published online: 18-05-2020)

14. Biochemical and immunological investigation of fascioliasis in cattle in Egypt

Nani Nasreldin and Rania Samir Zaki

Veterinary World, 13(5): 923-930

ABSTRACT

Background and Aim: Fasciola hepatica and Fasciola gigantica are two commonly reported liver flukes that cause fascioliasis in ruminants. Among the members of the genus Fasciola, F. hepatica was identified in the study area. Fascioliasis is a major disease that affects the production of livestock by causing liver damage. F. hepatica has developed advanced mechanisms to trick, elude, and alter the host immune response, similar to an extrinsic stressor. These mechanisms consequently affect the animals' physiological and metabolic functions in vivo and postmortem changes, which have significant influences on animal welfare and meat quality development. Therefore, this study aimed to determine the current prevalence of cattle fascioliasis at abattoirs in El-Kharga city, New Valley Governorate, Egypt, and to investigate the changes in serum biochemical and immunological parameters and oxidative stress factors due to Fasciola spp. infection in terms of meat quality and immune response.

Materials and Methods: A total of 226 cattle were inspected for the presence of Fasciola spp. The liver of each cattle was examined by making several incisions for detecting adult Fasciola spp. in El- Kharga . The blood samples were collected to analyze the changes in serum biochemical and immunological parameters and oxidative stress factors.

Results: Of the 226 cattle, 38 (16.81%) were positive for F. hepatica at the postmortem examination. Cattle infected with F. hepatica had highly elevated serum alanine aminotransferase, aspartate aminotransferase, glutamate dehydrogenase, γ-glutamyl transferase, urea, and creatinine levels. Immunological cytokine profiles showed significantly increased serum interleukin (IL)-4, IL-10, and transforming growth factor-beta levels and a significantly decreased interferon-γ level. Furthermore, oxidative stress profiles showed significantly increased serum malondialdehyde and nitric oxide levels and significantly decreased total antioxidant capacity and reduced glutathione level.

Conclusion: This study demonstrated that F. hepatica infection alone is an oxidative stress factor that affects slaughtered animals, leading to biochemical and metabolic alterations in the early postmortem period.

Keywords: cattle, Fasciola hepatica, fascioliasis, immune and biochemical response, liver damage.

Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China

Research (Published online: 18-05-2020)

13. Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China

Qiao Mengfan, Wang Lixia, Lei Ying, Ren Yan, Cai Kuojun, Zhang Jinsheng, Zhang Zaichao, Yu Weiwei, Peng Yelong, Cai Xuepeng, Li Chongyang, Qiao Jun and Meng Qingling

Veterinary World, 13(5): 916-922

ABSTRACT

Background and Aim: As a tick-borne zoonotic pathogen, Ehrlichia canis has already posed a threat to public health and safety. This study aimed to clarify the prevalence and molecular characteristics of E. canis in pet dogs in Xinjiang, China.

Materials and Methods: A total of 297 blood samples of pet dogs and 709 skin ticks (Rhipicephalus sanguineus sensu lato) were subjected to molecular detection using PCR for E. canis 16S rRNA gene, and then, positive samples were amplified, sequenced, and phylogenetically analyzed for E. canis gp36 gene.

Results: The PCR detection showed that the positive rate of PCR was 12.12% (36/297) in blood samples and 15.23% (108/709) in tick samples, respectively. Based on the phylogenetic analysis of E. canis gp36 protein, these E. canis strains in different geographical regions of the world can be divided into Genogroup I and Genogroup II. Among them, the Xinjiang epidemic strain XJ-6 and 533, 36, 1055, Kasur1, and Jake strains were clustered into subgroup 1.1 of Genogroup I, while the XJ-2, XJ-21, and XJ-35 strains and the TWN1, TWN4, CM180, and CM196 strains were closely related and belonged to subgroup 2.2 of Genogroup II, displaying high genetic diversity.

Conclusion: This is the first study focusing on the molecular epidemiology of E. canis infection in pet dogs, which revealed that E. canis infection had been occurred in Xinjiang, China. More importantly, this study confirmed that the substantial variability in immunoreactive protein gp36 from E. canis strains circulating in pet dogs.

Keywords: Ehrlichia canis, genetic characteristics, gp36, pet dog, Rhipicephalus sanguineus sensu lato.

Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand

Research (Published online: 16-05-2020)

12. Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand

Jutamas Wongwigkan and Tawin Inpankaew

Veterinary World, 13(5): 909-915

ABSTRACT

Background and Aim: Hookworms are parasitic nematodes that live in the small intestine of their mammalian hosts including humans, dogs, and cats. This study was conducted to determine the prevalence and perform genetic characterization of hookworms using molecular techniques and to elucidate the risk factors associated with hookworm infections among semi-domesticated dogs residing in temples in the Bangkok Metropolitan Area, Thailand.

Materials and Methods: A total of 500 fecal samples were collected from semi-domesticated dogs from 91 temples in 48 districts of Bangkok. DNA was extracted and screened using internal transcribed spacer polymerase chain reaction-restriction fragment length polymorphism. In addition, samples positive for Ancylostoma ceylanicum were further characterized at the haplotype level based on the analysis of the mitochondrial cytochrome oxidase-1 gene (cox1).

Results: The prevalence of hookworm infections in semi-domesticated dogs was 6.2% (31/500). Hookworm infections were detected in temple-community dogs in 12 of 48 districts (25.0%), with Bang Khen and Lak Si districts having the highest proportion of infected dogs (22.6%). Regarding molecular characterization of hookworm species, 21 positive samples (67.74%) were infected with A. ceylanicum and 10 (32.26%) with Ancylostoma caninum. Characterization of cox1 in A. ceylanicum isolates revealed the presence of a mixture of human and dog isolates.

Conclusion: Semi-domesticated dogs act as a potential source of hookworm infections for human and animal populations in Bangkok, Thailand.

Keywords: Bangkok, hookworm, semi-domesticated dogs, Thailand.

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Research (Published online: 15-05-2020)

11. Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

G. Y. Suryawan, I. W. Suardana and I. N. Wandia

Veterinary World, 13(5): 905-908

ABSTRACT

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs.

Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.

Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.

Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.

Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Research (Published online: 15-05-2020)

10. Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Hung Vu-Khac, T. T. Hang Trinh, T. T. Giang Nguyen, X. Truong Nguyen and Thi Thinh Nguyen

Veterinary World, 13(5): 896-904

ABSTRACT

Aim: The study was conducted to determine the prevalence and characterization of the Pasteurella multocida isolates from suspected pigs in Vietnam.

Materials and Methods: A total of 83 P. multocida strains were isolated from lung samples and nasal swabs collected from pigs associated with pneumonia, progressive atrophic rhinitis, or reproductive and respiratory symptoms. Isolates were subjected to multiplex polymerase chain reaction (PCR) for capsular typing, detection of virulence-associated genes and antibiotic resistance genes by PCR. The antimicrobial sensitivity profiles of the isolates were tested by disk diffusion method.

Results: All the isolates 83/83 (100%) were identified as P. multocida by PCR: serogroup A was obtained from 40/83 (48.19%), serogroup D was detected from 24/83 strains (28.91%), and serogroup B was found in 19/83 (22.35%) isolates. The presence of 14 virulence genes was reported including adhesins group (ptfA – 93.97%, pfhA – 93.97%, and fimA – 90.36%), iron acquisition (exbB – 100%, and exbD – 85.54%), hyaluronidase (pmHAS – 84.33%), and protectins (ompA – 56.62%, ompH 68.67%, and oma87 – 100%). The dermonecrotoxin toxA had low prevalence (19.28%). The antimicrobial susceptibility testing revealed that cephalexin, cefotaxime, ceftriaxone, ofloxacin, pefloxacin, ciprofloxacin, and enrofloxacin were the drugs most likely active against P. multocida while amoxicillin and tetracycline were inactive. The usage of PCR revealed that 63/83 isolates were carrying at least one of the drug resistance genes.

Conclusion: Unlike other parts of the word, serotype B was prevalent among Vietnamese porcine P. multocida strains. The high antibiotic resistance detected among these isolates gives us an alert about the current state of imprudent antibiotic usage in controlling the pathogenic bacteria.

Keywords: antibiotic resistance, capsule serotype, Pasteurella multocida, virulence factors.

Cardiac troponin I as a cardiac biomarker has prognostic and predictive value for poor survival in Egyptian buffalo calves with foot-and-mouth disease

Research (Published online: 14-05-2020)

9. Cardiac troponin I as a cardiac biomarker has prognostic and predictive value for poor survival in Egyptian buffalo calves with foot-and-mouth disease

Mahmoud Aly, Mohamed Nayel, Akram Salama, Emad Ghazy and Ibrahim Elshahawy

Veterinary World, 13(5): 890-895

ABSTRACT

Background and Aim: Foot-and-mouth disease (FMD) causes huge economic losses in Egypt due to reductions in the production of red meat, milk, and milk by-products and can also lead to myocarditis in young animals. The aim of our study was to evaluate cardiac biomarkers, in particular cardiac troponin I (cTnI), and to reveal the relations of cardiac biomarkers with poor survival in FMD-infected Egyptian buffalo calves.

Materials and Methods: Forty-two Egyptian buffalo calves were included in this study. The calves were divided into 12 apparently healthy control calves and 30 calves clinically diagnosed with FMD during a disease outbreak in Menofia and Behera Governorates, Egypt. The diseased calves were divided, according to age, into 13 calves <3 months old and 17 calves between 3 and 6 months old. The animals were examined clinically and subjected to analysis of cardiac biomarkers.

Results: Biochemical analysis revealed significant elevations of cardiac biomarkers, especially creatine kinase myocardial band (CK-MB), lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), cardiac troponin T (cTnT), and cardiac troponin I (cTnI) in FMD-infected calves in comparison with control calves. There was a significant association between cTnI and poor survival in infected calves.

Conclusion: Cardiac biomarkers could be used as a rapid method for diagnosis of myocarditis induced by FMD in Egyptian buffalo calves. In addition, cTnI is a very sensitive and accurate tool for determining myocardial cell damage in the earlier stages of the disease and a good predictor of poor survival in calves.

Keywords: cardiac troponin I, Egyptian buffalo calves, foot-and-mouth disease, myocarditis.