Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Research (Published online: 15-05-2020)

11. Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

G. Y. Suryawan, I. W. Suardana and I. N. Wandia

Veterinary World, 13(5): 905-908

ABSTRACT

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs.

Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.

Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.

Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.

Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Research (Published online: 15-05-2020)

10. Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Hung Vu-Khac, T. T. Hang Trinh, T. T. Giang Nguyen, X. Truong Nguyen and Thi Thinh Nguyen

Veterinary World, 13(5): 896-904

ABSTRACT

Aim: The study was conducted to determine the prevalence and characterization of the Pasteurella multocida isolates from suspected pigs in Vietnam.

Materials and Methods: A total of 83 P. multocida strains were isolated from lung samples and nasal swabs collected from pigs associated with pneumonia, progressive atrophic rhinitis, or reproductive and respiratory symptoms. Isolates were subjected to multiplex polymerase chain reaction (PCR) for capsular typing, detection of virulence-associated genes and antibiotic resistance genes by PCR. The antimicrobial sensitivity profiles of the isolates were tested by disk diffusion method.

Results: All the isolates 83/83 (100%) were identified as P. multocida by PCR: serogroup A was obtained from 40/83 (48.19%), serogroup D was detected from 24/83 strains (28.91%), and serogroup B was found in 19/83 (22.35%) isolates. The presence of 14 virulence genes was reported including adhesins group (ptfA – 93.97%, pfhA – 93.97%, and fimA – 90.36%), iron acquisition (exbB – 100%, and exbD – 85.54%), hyaluronidase (pmHAS – 84.33%), and protectins (ompA – 56.62%, ompH 68.67%, and oma87 – 100%). The dermonecrotoxin toxA had low prevalence (19.28%). The antimicrobial susceptibility testing revealed that cephalexin, cefotaxime, ceftriaxone, ofloxacin, pefloxacin, ciprofloxacin, and enrofloxacin were the drugs most likely active against P. multocida while amoxicillin and tetracycline were inactive. The usage of PCR revealed that 63/83 isolates were carrying at least one of the drug resistance genes.

Conclusion: Unlike other parts of the word, serotype B was prevalent among Vietnamese porcine P. multocida strains. The high antibiotic resistance detected among these isolates gives us an alert about the current state of imprudent antibiotic usage in controlling the pathogenic bacteria.

Keywords: antibiotic resistance, capsule serotype, Pasteurella multocida, virulence factors.

Cardiac troponin I as a cardiac biomarker has prognostic and predictive value for poor survival in Egyptian buffalo calves with foot-and-mouth disease

Research (Published online: 14-05-2020)

9. Cardiac troponin I as a cardiac biomarker has prognostic and predictive value for poor survival in Egyptian buffalo calves with foot-and-mouth disease

Mahmoud Aly, Mohamed Nayel, Akram Salama, Emad Ghazy and Ibrahim Elshahawy

Veterinary World, 13(5): 890-895

ABSTRACT

Background and Aim: Foot-and-mouth disease (FMD) causes huge economic losses in Egypt due to reductions in the production of red meat, milk, and milk by-products and can also lead to myocarditis in young animals. The aim of our study was to evaluate cardiac biomarkers, in particular cardiac troponin I (cTnI), and to reveal the relations of cardiac biomarkers with poor survival in FMD-infected Egyptian buffalo calves.

Materials and Methods: Forty-two Egyptian buffalo calves were included in this study. The calves were divided into 12 apparently healthy control calves and 30 calves clinically diagnosed with FMD during a disease outbreak in Menofia and Behera Governorates, Egypt. The diseased calves were divided, according to age, into 13 calves <3 months old and 17 calves between 3 and 6 months old. The animals were examined clinically and subjected to analysis of cardiac biomarkers.

Results: Biochemical analysis revealed significant elevations of cardiac biomarkers, especially creatine kinase myocardial band (CK-MB), lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), cardiac troponin T (cTnT), and cardiac troponin I (cTnI) in FMD-infected calves in comparison with control calves. There was a significant association between cTnI and poor survival in infected calves.

Conclusion: Cardiac biomarkers could be used as a rapid method for diagnosis of myocarditis induced by FMD in Egyptian buffalo calves. In addition, cTnI is a very sensitive and accurate tool for determining myocardial cell damage in the earlier stages of the disease and a good predictor of poor survival in calves.

Keywords: cardiac troponin I, Egyptian buffalo calves, foot-and-mouth disease, myocarditis.

Single nucleotide polymorphisms in the growth hormone receptor gene and Alu1 polymorphisms in the diacylglycerol acyltransferase 1 gene as related to meat production in sheep

Research (Published online: 14-05-2020)

8. Single nucleotide polymorphisms in the growth hormone receptor gene and Alu1 polymorphisms in the diacylglycerol acyltransferase 1 gene as related to meat production in sheep

Nada H. Altwaty, Lamiaa M. Salem and Karima F. Mahrous

Veterinary World, 13(5): 884-889

ABSTRACT

Aim: This study aimed to investigate the polymorphisms in genes related to meat production, including growth hormone receptor (GHR) and diacylglycerol acyltransferase 1 (DGAT1) genes, in different breeds of sheep, including Barki, Najdi, and Harri.

Materials and Methods: Blood samples were collected from 75 randomly selected healthy Barki, Najdi, and Harri breeds of sheep, with 25 samples per breed. GHR and DGAT1 genes were identified using a single nucleotide polymorphism assay followed by digestion with the restriction enzyme Alu1.

Results: The analysis of the GHR gene sequence showed nucleotide substitutions at nt 69 in exon 10 (c.69 G > A); this mutation is considered a transition mutation. The sequences of detected SNPs in the GHR gene in the different sheep breeds were submitted to the GenBank database with accession numbers MG906773 to MG906781. The substitutions at exon 10 (c.69 G > A) results in an alteration to the amino acid (p. Lysine > Arginine). At c.69, the A allele frequency was 0.61, 0.59, and 0.54, while the G allele frequency was 0.39, 0.41, and 0.46, for Barki, Najdi, and Harri breeds, respectively. The genotype AG at nt 69 locus had the highest frequency in the Najdi and Harri sheep. The frequency of AG was 0.62, 0.61, and 0.64, while the frequency of AA was 0.30, 0.28, and 0.22, for Barki, Najdi, and Harri sheep, respectively. After digestion with the restriction enzyme AluI, the DGAT1 locus had two genotypes, CC and CT. The highest frequency, 0.88, was found for allele C, which was detected in Barki breed. The lowest frequency, 0.75, for the same allele was found for Harri.

Conclusion: The detected CT genotype may explain the moderate intramuscular fat content and muscle marbling in the Barki sheep breed.

Keywords: genetic polymorphism, polymerase chain reaction-restriction fragment length polymorphism, sequencing, sheep.

Antimicrobial activity of marigold (Tagetes erecta), mulberry (Morus indica), and red shallot (Allium ascalonicum) extracts against Streptococcus agalactiae

Research (Published online: 12-05-2020)

10. Antimicrobial activity of marigold (Tagetes erecta), mulberry (Morus indica), and red shallot (Allium ascalonicum) extracts against Streptococcus agalactiae

Tanawadee Mekvimol, Gannika Poonthong, Chayanit Chaipunna and Natapol Pumipuntu

International Journal of One Health, 6(1): 56-60

ABSTRACT

Background and Aim: The increasing antimicrobial resistance with reduced susceptibility to antimicrobial drugs is becoming a major concern for both human and animal, which raises health morbidity and mortality rate of cases that cannot be treated by antibiotics. Nowadays, there are many efforts to minimize the misuse of antibiotics. This study evaluated the antimicrobial activity of the crude ethanolic extracts of three Thai herbs divided in four groups; petals of marigold (Tagetes erecta), mulberry leaves and root barks (Morus indica), and whole onions of red shallot (Allium ascalonicum) against Streptococcus agalactiae.

Materials and Methods: The antimicrobial activity of four groups of the crude extracts using absolute ethanol from three Thai herbs was tested against standard strains of S. agalactiae using the agar well diffusion method. The commercial antibiotics ceftriaxone and erythromycin were used as positive control standards to determine the sensitivity of S. agalactiae.

Results: The result showed that all four groups of Thai herbal extract had inhibitory activity against standard strains of S. agalactiae. The inhibitory concentration test values were obtained using the dilution test at 25, 50, and 75 mg/ml. The maximum antimicrobial activity against S. agalactiae was observed in the ethanolic extracts from red shallot extract, followed by leaves of mulberry, petals of marigold, and root barks of mulberry, respectively.

Conclusion: The results demonstrated that the crude extract of three Thai herbs had antimicrobial activity inhibiting the growth of S. agalactiae and suggesting that they may be useful in the treatment of S. agalactiae infections in humans and animals.

Keywords: antimicrobial activity, ethanol extract, Streptococcus agalactiae, Thai herbal extracts.

Occurrence of multidrug-resistant Salmonella in cattle carcass and contact surfaces in Kwata slaughterhouse, Awka, Anambra State, Nigeria

Research (Published online: 12-05-2020)

9. Occurrence of multidrug-resistant Salmonella in cattle carcass and contact surfaces in Kwata slaughterhouse, Awka, Anambra State, Nigeria

Uju Catherine Okafor, Simeon Chibuko Okafor and Akwoba Joseph Ogugua

International Journal of One Health, 6(1): 49-55

ABSTRACT

Background and Aim: Contamination of meat with Salmonella could result in food-borne disease outbreaks among the consumers. However, there is a dearth of data assessing the presence of Salmonella in beef in Anambra State. Therefore, this study determined the prevalence and antimicrobial susceptibility of Salmonella in beef and slaughter/processing facilities in Kwata slaughterhouse.

Materials and Methods: Swab samples (200) randomly collected were cultured for the isolation of Salmonella and the isolates subjected to antimicrobial susceptibility test. Data obtained were analyzed using t-test and analysis of variance with p< 0.05 considered statistically significant.

Results: Of the 200 samples cultured, 33.5% (67/200) yielded Salmonella isolates. The mean Salmonella load (colony-forming unit [CFU]/cm2) for different contact surfaces (before and after contact with carcasses) was as follows: Slaughter floor, 1.1×1010±1.1×106a and 1.0×1010±1.1×106b; display table, 1.1×1010±11.1×106a and 1.0×1010±1.1×106b; washing bucket 1.01×1010±1.0×106a and 0.8×1010±0.1×106b; knife, 1.1×1010±1.10×106a and 1×1010±1.0×106b; boot, 1.1×1010±1.0×106a and 1.0×1010±1.10×106b; file, 1.1×1010±1.0×106a and 1.0×1010±0.1×106b; and wheelbarrow, 1.1×1010±1.0×106a and 1.01×1010±0.11×106b. Salmonella counts decreased significantly (p<0.05) in the presented order from slaughter floor to wheelbarrow after contact with carcasses. On the other hand, there was a significant (p<0.05) increase in washing water Salmonella counts before and after (0.7×1010±0.10×106a and 1.0×1010±1.0×106b CFU/100 ml) carcasses wash. To each of the antimicrobials tested, the percentage of the 67 isolates found resistant was as follows: ciprofloxacin, 25.4%; ofloxacin, 27%; ceftriaxone, 35.8%; amoxicillin/clavulanic acid, 88.1%; chloramphenicol, 59.7%; gentamicin, 34.3%; streptomycin, 49.3%; nalidixic acid, 49.3%; trimethoprim/sulfamethoxazole, 76%; nitrofurantoin, 89.6%; and ampicillin, 100%.

Conclusion: Antimicrobial-resistant Salmonella were isolated from beef and slaughter/processing facilities in Anambra State. This underscores the need for a coordinated one health approach for the improvement of hygienic standard during slaughter/processing in the slaughterhouse surveyed, to limit meat contamination and hence safeguard human health.

Keywords: beef, contact surfaces, Kwata slaughterhouse, resistance, Salmonella.

Profile of follicle-stimulating hormone and polymorphism of follicle-stimulating hormone receptor in Madrasin cattle with ovarian hypofunction

Research (Published online: 11-05-2020)

7. Profile of follicle-stimulating hormone and polymorphism of follicle-stimulating hormone receptor in Madrasin cattle with ovarian hypofunction

Budi Utomo, Emmanuel Djoko Putranto and Amaq Fadholly

Veterinary World, 13(5): 879-883

ABSTRACT

Background and Aim: The follicle-stimulating hormone (FSH) gene is an essential regulator of fertility in livestock. This study aims to provide information on the genetic makeup of Madrasin cattle experiencing hypofunction by the FSH profile and FSH receptors (FSHR) polymorphism.

Materials and Methods: Blood samples were collected from the Bangkalan regency in Indonesia. DNA was isolated and purified following the extraction protocol of polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism.

Results: Our results showed that the FSH gene had a band length of 310 bp and produce two alleles (A and B) with restriction enzymes at 250 bp, 230 bp, and 145 bp. Furthermore, the FSHR gene had a band length of 303 bp and produced two homozygous genotypes: GG at bp 239 and CC at bp 188.

Conclusion: Based on these differences, there was no change in allele frequency and genotype between Madura and Madrasin cattle due to crossbreeding with Limousin cattle. Thus, further detailed investigations of Madrasin cattle are required to elucidate the profile of the LH and LHR genes.

Keywords: follicle-stimulating hormone, follicle-stimulating hormone receptors, hypofunction, Madrasin.