Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Research (Published online: 25-05-2018)

18. Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Foukpe Zhairath Adambi Boukari, Ibrahim Traore Alkoiret, Soumanou Seibou Toleba, Athanase Ahissou, Fataou Zacharie Toure, Aliyassou Mama Yacoubou, Gabriel Assouan Bonou, Ignace Ogoudanan Dotche, Victoire Akpaki and Issaka Youssao Abdou Karim

Veterinary World, 11(5): 693-699

ABSTRACT

Aim: The current study aims to evaluate the reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm.

Materials and Methods: Semen from exotic breeds was used to inseminate 70 Borgou cows on induced estrus with the norgestomet implant and 285 others on natural estrous. Data on the reproductive performances of inseminated cows were collected.

Results: In inseminated cows on induced estrus, the pregnancy rate was 30% and that of abortion was 9.52%. The fertility rate was 28.57% and those of live births and mortality were, respectively, 105.26% and 5% in these cows. As for inseminated cows on natural estrus, the pregnancy rate was 75.79% and the one of calving was 88.89%. The fertility rate recorded with natural estrous was 66.67% and was significantly higher than the one recorded with insemination on induced estrus. The live births and the birth-weaning mortality rates were, respectively, 98.96% and 11.58% in inseminated cows on natural estrus.

Conclusion: Reproductive performances are better in Borgou cows inseminated on natural estrus than in those inseminated on induced estrus.

Keywords: artificial insemination, Benin, cattle, reproductive performances.

Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Research (Published online: 24-05-2018)

17. Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Khumaji Badaji Kataviya, Bharat Parmar, Ramesh Patel, Pranab Jyoti Das, Vivek Kumar, Amit Mahajan, Ravinder Singh, Devesh Thakur, Amol Kinhekar, R. K. Ravikumar and Vipin Kumar

Veterinary World, 11(5): 687-692

ABSTRACT

Aim: This study was conducted to demonstrate the acaricide efficacy of novel indigenous veterinary medication shared by an outstanding knowledge holder against naturally infested cattle and efforts in mainstreaming such wisdom.

Materials and Methods: An indigenous herbal medication in control of tick infestation was documented, and experimentation was held against naturally affected cattle. Eighteen clinically infested cattle population comprising 16 crossbred and 2 non-descript cattle were purposively selected. Majority of them were adult females, reported with a higher incidence of tick at Veterinary institution. The average pre-treatment tick count at 24 sites of observations among these animals was 18.91±2.04 (Mean [x̄]±standard error [SE]). The medication was topically applied once daily for 2 days and post-treatment observations were recorded for an experimental period of 14 days' duration.

Results: During 24-h post-treatment observation, the medication had shown 92.95% acaricidal property with clinically irrelevant rate of tick infestation of 1.33±0.39 (x̄±SE) was noticed before application of subsequent (second) dosage. This practice was found significantly effective at 5% level of significance (t0.05, 23=9.08) illustrating faster relief to livestock. Animals were treated with herbal medication as per dosage on the second day and no reinfestation was noticed up to 14 days of experimental observation.

Conclusion: The study strengthens the belief that indigenous herbal acaricide can facilitate quality livestock service at geographically distant locations. These medications can provide quicker relief, minimize tick resistance and are favorable to the environment.

Keywords: acaricide, indigenous, institution, livestock, ruminant, tick.

Cryptosporidiosis: A zoonotic disease concern

Review (Published online: 23-05-2018)

16. Cryptosporidiosis: A zoonotic disease concern

Natapol Pumipuntu and Supawadee Piratae

Veterinary World, 11(5): 681-686

ABSTRACT

Cryptosporidiosis is considered to be a crucial zoonotic disease caused by worldwide distributing parasitic protozoa called Cryptosporidium spp. Cryptosporidiosis becomes a major public health and veterinary concern by affecting in human and various host range species of animals. Essentially, its importance of infection is increasing because of the high incidence in young children, immunocompromised persons, or immunodeficiency syndrome patients, especially in HIV/AIDS, and it is also one of the most causes of mortality in those patients who infected with Cryptosporidium spp. as well as young animals. All domestic animal, livestock, wildlife, and human can be potential reservoirs that contribute Cryptosporidium spp. to food and surface waters and transmitted to other hosts through fecal-oral route. The oocyst stage of Cryptosporidiumspp. can remain infective and resistant to various environmental exposure and also resistant to many general disinfecting agents including chlorination which normally used in water treatment. Therefore, the understanding of these zoonotic pathogens is very essential in both animal and human health. This review focuses on the biology, life cycle, transmission, diagnosis, treatment, prevention, and control of this protozoan infection to emphasize and remind as the significant One Health problem.

Keywords: cryptosporidiosis, diarrhea, waterborne disease, zoonosis.

Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

Research (Published online: 22-05-2018)

15. Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

K. T. Biobaku, T. O. Omobowale, Ahmed O. Akeem, A. Aremu, N. Okwelum and A. S. Adah

Veterinary World, 11(5): 674-680

ABSTRACT

Aim: The study determined the effect of ascorbic acid (administered orally and intramuscularly) in short-term transportation stress.

Materials and Methods: Twenty-four apparently healthy Kalahari goats were grouped into four groups (A, B, C, and D) of 6 animals each: Group A - untreated and unexposed to stress; Group B - treated with 200 mg/kg Vitamin C orally and exposed to 2 h transportation stress; Group C - treated with Vitamin C 200 mg/kg intramuscularly and exposed to 2 h transportation stress; and Group D - untreated and exposed to 2 h transportation stress. The animals were stocked using standards stipulated by the Nigerian Animal Disease Control Act and transported at 40 km/h. Cortisol and interleukin-6 (IL-6) were assayed using quantitative sandwich ELISA. Classical stress hematological parameters and antioxidative stress markers such as glutathione s-transferase, superoxide dismutase, and malondialdehyde were determined. Heart rate variability (HRV) was also assessed.

Results: The route of ascorbic acid administration did not influence the expression of IL-6, and changes in cortisol surge, antioxidative stress markers, and other hematological parameters in Kalahari goats though Group C goats showed higher HRV values (p<0.05) than others. This gives credence to the enhanced cardiac responsiveness and stress survivability in Kalahari goats.

Conclusion: Both routes could be used in the administration of ascorbic acid. Kalahari goats exposed to short-term stress; however, the intramuscular route had better heart variability and thus improved the survivability of the animals.

Keywords: ascorbic acid, intramuscular, oral, Kalahari goats, stress.

Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

Research (Published online: 21-05-2018)

14. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

S. R. Eman, A. A. Kubesy, T. A. Baraka, F. A. Torad, I. S. Shaymaa and Faten F. Mohammed

Veterinary World, 11(5): 667-673

ABSTRACT

Aim: This study was performed to evaluate the diagnostic value of hepatocyte-derived microRNA (miRNA)-122 in acute and chronic hepatitis of dogs.

Materials and Methods: A total of 26 dogs presented at Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Cairo University, 16 dogs out of 26 showing clinical signs of hepatic insufficiency were subjected to clinical, ultrasonographic, hematobiochemical and ultrasound-guided fine-needle biopsy for cytological and histopathological investigations. On the basis of these results, 7 dogs out of 16 dogs were found to be suffering from acute hepatitis and 9 dogs suffering from chronic hepatitis. 10 clinically healthy dogs were kept as control. Serum hepatocyte-derived miRNA-122 was analyzed by real-time quantitative polymerase chain reaction in all dogs.

Results: The dogs suffering from acute hepatitis manifested jaundice, vomiting, and depression while dogs with chronic hepatitis manifested anorexia, abdominal distension, weight loss, and melena. Hematological parameters showed normocytic normochromic anemia and thrombocytopenia in both acute and chronic hepatitis groups. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total bilirubin were significantly higher than control values in acute hepatitis. In chronic hepatitis, total protein and albumin were significantly lower than control values with normal ALT, AST, ALP, and gamma-glutamyltransferase values. Ultrasonography revealed a diffuse decrease in hepatic echogenicity in acute hepatitis while the increase in hepatic echogenicity and anechoic ascetic fluid in chronic hepatitis. Cytology revealed hepatic vacuolar degeneration and histopathology revealed necrosis and apoptosis of hepatocyte in acute hepatitis while revealed massive fibrous tissue proliferation in hepatic parenchyma in chronic hepatitis. Serum miRNA-122 analysis, normalized for glyceraldehyde-3- phosphate dehydrogenase expression revealed a significant increase in acute hepatitis accompanied with elevation in ALT and AST, while in chronic hepatitis, elevation of serum miRNA-122 was accompanied with ALT and AST of the normal range.

Conclusion: Serum hepatocyte-derived miRNA-122 is of diagnostic value and highly stable blood indicator for the detection of hepatocellular injury in dogs than aminotransferases, especially in cases where aminotransferases do not exceed normal serum level.

Keywords: canine, cytology and histopathology, hepatitis, hepatocyte derived miRNA-122, ultrasonography.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)

13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti

Veterinary World, 11(5): 657-666

ABSTRACT

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)

12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior

Veterinary World, 11(5): 649-656

ABSTRACT

Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.

Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.

Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.

Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.

Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.