Cryptosporidiosis: A zoonotic disease concern

Review (Published online: 23-05-2018)

16. Cryptosporidiosis: A zoonotic disease concern

Natapol Pumipuntu and Supawadee Piratae

Veterinary World, 11(5): 681-686

ABSTRACT

Cryptosporidiosis is considered to be a crucial zoonotic disease caused by worldwide distributing parasitic protozoa called Cryptosporidium spp. Cryptosporidiosis becomes a major public health and veterinary concern by affecting in human and various host range species of animals. Essentially, its importance of infection is increasing because of the high incidence in young children, immunocompromised persons, or immunodeficiency syndrome patients, especially in HIV/AIDS, and it is also one of the most causes of mortality in those patients who infected with Cryptosporidium spp. as well as young animals. All domestic animal, livestock, wildlife, and human can be potential reservoirs that contribute Cryptosporidium spp. to food and surface waters and transmitted to other hosts through fecal-oral route. The oocyst stage of Cryptosporidiumspp. can remain infective and resistant to various environmental exposure and also resistant to many general disinfecting agents including chlorination which normally used in water treatment. Therefore, the understanding of these zoonotic pathogens is very essential in both animal and human health. This review focuses on the biology, life cycle, transmission, diagnosis, treatment, prevention, and control of this protozoan infection to emphasize and remind as the significant One Health problem.

Keywords: cryptosporidiosis, diarrhea, waterborne disease, zoonosis.

Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

Research (Published online: 22-05-2018)

15. Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

K. T. Biobaku, T. O. Omobowale, Ahmed O. Akeem, A. Aremu, N. Okwelum and A. S. Adah

Veterinary World, 11(5): 674-680

ABSTRACT

Aim: The study determined the effect of ascorbic acid (administered orally and intramuscularly) in short-term transportation stress.

Materials and Methods: Twenty-four apparently healthy Kalahari goats were grouped into four groups (A, B, C, and D) of 6 animals each: Group A - untreated and unexposed to stress; Group B - treated with 200 mg/kg Vitamin C orally and exposed to 2 h transportation stress; Group C - treated with Vitamin C 200 mg/kg intramuscularly and exposed to 2 h transportation stress; and Group D - untreated and exposed to 2 h transportation stress. The animals were stocked using standards stipulated by the Nigerian Animal Disease Control Act and transported at 40 km/h. Cortisol and interleukin-6 (IL-6) were assayed using quantitative sandwich ELISA. Classical stress hematological parameters and antioxidative stress markers such as glutathione s-transferase, superoxide dismutase, and malondialdehyde were determined. Heart rate variability (HRV) was also assessed.

Results: The route of ascorbic acid administration did not influence the expression of IL-6, and changes in cortisol surge, antioxidative stress markers, and other hematological parameters in Kalahari goats though Group C goats showed higher HRV values (p<0.05) than others. This gives credence to the enhanced cardiac responsiveness and stress survivability in Kalahari goats.

Conclusion: Both routes could be used in the administration of ascorbic acid. Kalahari goats exposed to short-term stress; however, the intramuscular route had better heart variability and thus improved the survivability of the animals.

Keywords: ascorbic acid, intramuscular, oral, Kalahari goats, stress.

Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

Research (Published online: 21-05-2018)

14. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

S. R. Eman, A. A. Kubesy, T. A. Baraka, F. A. Torad, I. S. Shaymaa and Faten F. Mohammed

Veterinary World, 11(5): 667-673

ABSTRACT

Aim: This study was performed to evaluate the diagnostic value of hepatocyte-derived microRNA (miRNA)-122 in acute and chronic hepatitis of dogs.

Materials and Methods: A total of 26 dogs presented at Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Cairo University, 16 dogs out of 26 showing clinical signs of hepatic insufficiency were subjected to clinical, ultrasonographic, hematobiochemical and ultrasound-guided fine-needle biopsy for cytological and histopathological investigations. On the basis of these results, 7 dogs out of 16 dogs were found to be suffering from acute hepatitis and 9 dogs suffering from chronic hepatitis. 10 clinically healthy dogs were kept as control. Serum hepatocyte-derived miRNA-122 was analyzed by real-time quantitative polymerase chain reaction in all dogs.

Results: The dogs suffering from acute hepatitis manifested jaundice, vomiting, and depression while dogs with chronic hepatitis manifested anorexia, abdominal distension, weight loss, and melena. Hematological parameters showed normocytic normochromic anemia and thrombocytopenia in both acute and chronic hepatitis groups. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total bilirubin were significantly higher than control values in acute hepatitis. In chronic hepatitis, total protein and albumin were significantly lower than control values with normal ALT, AST, ALP, and gamma-glutamyltransferase values. Ultrasonography revealed a diffuse decrease in hepatic echogenicity in acute hepatitis while the increase in hepatic echogenicity and anechoic ascetic fluid in chronic hepatitis. Cytology revealed hepatic vacuolar degeneration and histopathology revealed necrosis and apoptosis of hepatocyte in acute hepatitis while revealed massive fibrous tissue proliferation in hepatic parenchyma in chronic hepatitis. Serum miRNA-122 analysis, normalized for glyceraldehyde-3- phosphate dehydrogenase expression revealed a significant increase in acute hepatitis accompanied with elevation in ALT and AST, while in chronic hepatitis, elevation of serum miRNA-122 was accompanied with ALT and AST of the normal range.

Conclusion: Serum hepatocyte-derived miRNA-122 is of diagnostic value and highly stable blood indicator for the detection of hepatocellular injury in dogs than aminotransferases, especially in cases where aminotransferases do not exceed normal serum level.

Keywords: canine, cytology and histopathology, hepatitis, hepatocyte derived miRNA-122, ultrasonography.

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)

13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti

Veterinary World, 11(5): 657-666

ABSTRACT

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)

12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior

Veterinary World, 11(5): 649-656

ABSTRACT

Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.

Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.

Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.

Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.

Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.

Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Research (Published online: 18-05-2018)

11. Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Suppada Kananub, Wassana Jawjaroensri, John VanLeeuwen, Henrik Stryhn and Pipat Arunvipas

Veterinary World, 11(5): 642-648

ABSTRACT

Aim: The study was to determine seasonal fluctuations and non-nutritional factors associated with bulk tank milk urea nitrogen (BTMUN).

Materials and Methods: A total of 58,364 BTM testing records were collected from 2364 farms in Central Thailand during September 2014-August 2015. Using square root BTMUN as the outcome, other milk components, farm effect, and sampling time were analyzed by univariable repeated measures linear regression, and significant variables were included in multivariable repeated measures linear regression.

Results: The average BTMUN (standard deviation) was 4.71 (±1.16) mmol/L. In the final model, BTM fat and protein percentages were associated with BTMUN as quadratic and cubic polynomials, respectively. BTM lactose percentage and the natural logarithm of somatic cell counts were negatively linearly associated with BTMUN. At the farm level, the BTM lactose association was negatively linear; herd BTMUN decreased following an increase of herd lactose average, and BTM lactose slopes were quite different among farms as well. Sampling time had the highest potency for the estimation of BTMUN over time, with lows and highs occurring in August and October, respectively. The variation in test level BTMUN was decreased by 18.6% compared to the null model, and 6% of the variance could be explained at the farm level.

Conclusion: The results clarify seasonal variation in BTMUN and the relationships among other BTM constituents and BTMUN, which may be useful for understanding how to manage lactating dairy cattle better to keep BTM constituents within normal ranges.

Keywords: bulk tank milk urea nitrogen, farm level, non-nutritional factor, Thailand.

Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Research (Published online: 17-05-2018)

10. Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Mohammad Tabatabaei and Fatemeh Abdollahi

Veterinary World, 11(5): 636-641

ABSTRACT

Background and Aim: Mannheimia haemolytica is a Gram-negative, non-motile, and non-spore-forming rod-shaped coccobacillus bacterium. On blood agar plate, it shows complete hemolysis. This bacterium constitutes a part of normal flora of the upper respiratory system of ruminants. It is considered as the opportunistic pathogen and the main factor of pneumonic pasteurellosis, which has caused a severe economic loss in sheep and cattle industries. Considering the prevalence of the disease in sheep and goat population in the dry and hot regions of the country in general and in Fars province in particular in the form of pneumonia, the purpose of this study was to isolate and identify the bacterium M. haemolytica from the lung tissues of sheep slaughtered in Shiraz abattoir through culturing and polymerase chain reaction (PCR) methods.

Materials and Methods: In this study, a total of 2500 sheep's lungs were evaluated for finding pneumonic effects. Then, 161 infected pneumonic samples of lung tissues were investigated by culture and PCR methods.

Results: After cultivation, purification, and DNA extraction, 38 samples were found positive for M. haemolytica by cultivation and then all the 38 isolates were confirmed by PCR and multiplex PCR (mPCR). Results of this study indicated that culture and PCR are both practical in identification and isolation of this bacterium though culture is more time-consuming. The utilized mPCR has been more successful in the identification of the bacteria since it requires less time and cost.

Conclusion: In this study, PCR as a superior method among other methods of bacteriology for fast examination of infectious diseases and mPCR, which is a valuable tool for identification of M. haemolytica in clinical samples of animals, was used.

Keywords: Mannheimia haemolytica, pneumonia, polymerase chain reaction, sheep, Shiraz.