Friday, 8 June 2018

Impact of the Egyptian summer season on oxidative stress biomarkers and some physiological parameters in crossbred cows and Egyptian buffaloes

Research (Published online: 08-06-2018)
6. Impact of the Egyptian summer season on oxidative stress biomarkers and some physiological parameters in crossbred cows and Egyptian buffaloes
Maha M. Hady, T. M. Melegy and Shaimaa R. Anwar
Veterinary World, 11(6): 771-777
ABSTRACT
Aim: The current study aimed to compare the impact of heat stress (HS) on some physiological functions and blood oxidative stress biomarkers between dry dairy crossbred (Balady X Friesian) cows and buffaloes during Egyptian summer season (July-September).
Materials and Methods: A total of 26 healthy animals were equally used in the in the current study. The criterion for cows and buffaloes selection and the management conditions were similar. A total mixed ration to meet the animal's requirements was used, and dry matter intake (DMI) was calculated. Ambient temperature, relative humidity, temperature humidity index (THI), respiratory rate, and rectal temperature (RT) were daily recorded. Meanwhile, live body weight and body condition score were weekly recorded. Blood samples were collected bi-weekly, and plasma samples were harvested for malondialdehyde (MDA) content and enzymatic antioxidants such as glutathione peroxidase, superoxide dismutase, and catalase activities determinations throughout the experimental period (8 weeks - prepartum).
Results: The results confirmed, the HS condition, as the THI values ranged from 79.74 to 90.4 throughout the experimental period. In both species, HS increased RT and decreased DMI (<10.5 kg/day and 9.5 kg/day in cows and buffaloes, respectively). Buffaloes seemed to be more affected by the hostile environmental condition of this study compared with their respective cows. Buffaloes had recorded up to 1 °C increase in their RTs in most of the point's period compared to cows. There was a continuous increase in MDA values (194.7 and 208.4 nmol/gHb in buffaloes and cows, respectively, 2 weeks prepartum) as the animals come close to parturition with moderate decrements for the enzymatic antioxidant activities in both cows and buffaloes.
Conclusion: It can be concluded that during Egyptian's summer season, HS had adversely affected feed intake and consequently animal's production performances.
Keywords: buffaloes, dairy cows, Egyptian's summer, heat stress, oxidative stress.

Thursday, 7 June 2018

The immunomodulatory effect of green tea (Camellia sinensis) leaves extract on immunocompromised Wistar rats infected by Candida albicans

Research (Published online: 07-06-2018)
5. The immunomodulatory effect of green tea (Camellia sinensis) leaves extract on immunocompromised Wistar rats infected by Candida albicans
Retno P. Rahayu, Remita A. Prasetyo, Djoko A. Purwanto, Utari Kresnoadi, Regina P. D. Iskandar and Muhammad Rubianto
Veterinary World, 11(6): 765-770
ABSTRACT
Background and Aim: The immunocompromised condition is considered a defect in the immune system. This condition tends to increase the risk of oral candidiasis, due to the inability of the immune system to eliminate the adhesion of Candida albicans and leads to systemic candidiasis with a mortality rate of 60%. Green tea (Camellia sinensis) contains potential antioxidant and immunomodulatory which acts as anticancer, antifungal, and antivirus agent. The aim of this study was to invent herbal-based medicine, which acts as an immunomodulator and antifungal agent to treat fungal infection in immunocompromised patients.
Materials and Methods: Thirty-five immunocompromised Wistar rats induced with C. albicans were divided into 7 groups (n=5): Control group (C+); treated for 4 days with green tea extract 1.25% (GT 4), epigallocatechin gallate (EGCG) 1% (EGCG 4), EGC 1% (EGC 4); and treated for 7 days with green tea extract 1.25% (GT 7), EGCG 1% (EGCG 7), and EGC 1% (EGC 7). Tongue tissue was collected and analyzed with immunohistochemistry staining using monoclonal antibody; interleukin (IL)-17A, IL-8, and human beta-defensin 2 (HBD)-2. Data were analyzed using analysis of variance test and Tukey honest significant differences test.
Results: The expression of IL-17A, IL-8, and HBD-2 was significantly increased (p=0.000) after green tea extract administration in 7 days, whereas in 7 days, the expression of IL-8, IL-17A, and HBD-2 after EGCG and EGC administration did not give a significant result (p>0.005).
Conclusion: Within the limits of this study, green tea extract has the ability as an immunomodulatory agent in an immunocompromised patient infected by C. albicans through expression augmentation of IL-8, IL-17A, and HBD-2 compared to EGCG and EGC.
Keywords: epigallocatechin gallate, epigallocatechin, green tea extract, immunocompromised, oral candidiasis.

Effect of immobilized fungal phytase on growth performance and bone traits of broilers fed with low dietary calcium and phosphorus

Research (Published online: 07-06-2018)
4. Effect of immobilized fungal phytase on growth performance and bone traits of broilers fed with low dietary calcium and phosphorus
Sreeja Ajith, Divya Shet, Jyotirmoy Ghosh, Vaibhav B. Awachat, Karthik Bhat, Dintaran Pal and Arumbackam V. Elangovan
Veterinary World, 11(6): 758-764
Aim: The aim of this study was to investigate the effects of phytase which was laboratory produced by Aspergillus foetidus on the growth performance, mineral retention, and bone traits of broilers fed with low dietary calcium and phosphorus.
Materials and Methods: The extracellular phytase enzyme secreted into the crude filtrate was concentrated by ammonium sulfate precipitation to obtain an activity of 500 phytase units (FTU). A total of 90 1-day-old chicks (Cobb 500) were randomly divided into three treatment groups with five replicates having six birds each. Dietary treatment, T1, was with 0.45% non-phytate P (NPP) during starter and 0.40% during finisher phase with 1% Ca. Dietary treatment, T2, had 0.37% NPP during starter and 0.32% in finisher phase with 1% Ca and supplemental lab phytase at 500 FTU/kg. Dietary treatment, T3, was similar to T2 with a lower Ca of 0.8%.
Results: There was no significant difference among the dietary treatments with regard to body weight gain, feed intake, feed conversion ratio, and Ca retention (p>0.05). However, a significant improvement in retention of P by birds was observed in phytase supplemental groups T2 and T3 (p<0.05). Dry weight of tibia (2.58-2.78 g/kg live weight) and ash content (39.7- 41.8%) was comparable among treatments. A similar trend was observed for bone Ca, P, and Mn content.
Conclusion: The study indicated that 500 FTU/kg phytase can be effectively supplemented in a broiler diet with low phosphorus (0.37% in starter and 0.32% NPP in finisher diet) and low calcium (0.8% in diet) for better growth performance and with successful replacement of dietary P by 0.08 % and reduced P excretion into the environment in broiler chicken.
Keywords: broiler, calcium, phosphorus, phytase.

Wednesday, 6 June 2018

Evaluation of the General Organization of Veterinary Services control program of animal brucellosis in Egypt: An outbreak investigation of brucellosis in buffalo

Research (Published online: 06-06-2018)
3. Evaluation of the General Organization of Veterinary Services control program of animal brucellosis in Egypt: An outbreak investigation of brucellosis in buffalo
H. I. Hosein, Hoda Mohamed Zaki, Nesreen Mohamed Safwat, Ahmed M. S. Menshawy, Sherin Rouby, Ayman Mahrous and Bahaa El-deen Madkour
Veterinary World, 11(6): 748-757
ABSTRACT
Background and Aim: Brucellosis is a major constraint to livestock production in Egypt as well as many developing countries worldwide. Bovine brucellosis is an economically important disease with reproductive failure as a principal manifestation resulting in abortion, premature birth and decreased milk production in females, and orchitis and epididymitis in males. In spite of the efforts of Egyptian veterinary services to overcome brucellosis, the disease is still prevalent in both animals and humans and represents one of the most important public health hazards in Egypt. The aim of the present work was to investigate the efficacy of the control program implemented by the General Organization of Veterinary Services in Brucella infected buffalo farm on serological, molecular, cultural, and histopathological basis. Brucella melitensis biovar 3 was recovered from 6 buffalo-cows.
Materials and Methods: Blood samples were collected from a total of 750 non-vaccinated lactating buffalo-cows. These animals were proved positive for Brucella by the Egyptian brucellosis national program. Sera were tested using buffered acidified plate antigen test and rose Bengal test as screening tests and complement fixation test as a confirmatory test. Positive animals were separated for slaughtering under the supervision of the Egyptian veterinary authorities. Remaining animals were tested every 3 weeks with slaughtering of positive cases and this continued until the remaining animals revealed three successive negative serological tests. Different lymph nodes (prescapular, prefemoral, mediastinal, retropharyngeal, and supramammary) were collected from 11 Brucella seropositive buffalo-cows slaughtered after being confirmed serologically as Brucella infected cases. Samples were collected and processed for bacterial isolation and nucleic acid detection using polymerase chain reaction (PCR). Parts of these specimens were fixed in 10% neutral buffered formalin for 48 h then processed by paraffin embedding technique.
Results: "Test and slaughter" policy was applied on Brucella infected dairy buffalo farm. The program continued for 6 months with slaughtering of positive cases until the herd was proved Brucella free. B. melitensisbiovar 3 could be recovered from six buffalo-cows. Universal PCR confirmed Brucella on genus level and Bruce-ladder multiplex, PCR confirmed the presence of B. melitensis on the species level. Histopathological examination of Brucella-infected lymph nodes revealed massive rarified and depleted lymphoid areas of both sub-capsular and deep cortical lymphoid follicles, macrophage cells granulomatous reaction, as well as fat, infiltrates, and chronic vasculitis. The chronic nature of Brucella lesions has been confirmed in this study as indicated by the chronic vasculitis and collagen deposition.
Conclusion: Freedom status from brucellosis in this study required 6 months which are considered long time allowing the spread of infection to other localities especially under unhygienic conditions, husbandry system favoring mixed populations of different ages, sex, aborted and pregnant, and lack of controlled movement of animals. Therefore, effective control of animal brucellosis requires surveillance to identify infected animal herds, elimination of the reservoirs, and vaccination of young heifers. B. melitensis biovar 3 is the cause of the Brucella outbreak in buffalo which still remains the prevalent type of Brucella in Egypt. The disease runs a chronic course allowing further spread of infection.
Keywords: bruce-ladder, brucellosis, buffalo, histopathology, polymerase chain reaction.

Tuesday, 5 June 2018

Scrotal circumference: A predictor of testosterone concentration and certain attributes of seminal vesicles influencing buffalo male fertility

Research (Published online: 05-06-2018)
2. Scrotal circumference: A predictor of testosterone concentration and certain attributes of seminal vesicles influencing buffalo male fertility
S. Mahmood, A. Kumar, R. Singh, M. Sarkar, G. Singh, M. R. Verma and G. V. P. P. S. R. Kumar
Veterinary World, 11(6): 739-747
ABSTRACT
Aim: The aim of this study was to evaluate the relationship of scrotal circumference (SC) with plasma testosterone, seminal vesicles (SVs) weight, and its secretion as measurable indicators of fertility and also to sequence and establish phylogenetic relatedness of certain SV protein genes with other species as such integrated approach is lacking.
Materials and Methods: Altogether, 59 apparently healthy male buffaloes sacrificed at slaughterhouse were selected (irrespective of breed) for measuring SC and collecting blood and paired SVs. The SC was measured at greater curvature using soft thread. In the present study, blood plasma testosterone, cholesterol, protein, and glucose in addition to SV fructose, citric acid and proteins in SV fluid were also estimated. The SV tissue was fixed in RNAlater for RNA extraction.Male buffaloes were categorized as per total SV weight into Group I (<5.0 g), Group II (5.0-7.84 g), and Group III (>8.0 g) and dentitions-I (18 months), II (18-24 months), and III (24 months) to assess the effect of weight and dentition age on SC, SV weight, and its certain secretions. Data were analyzed using linear model procedure including Tukey HSD test and Pearson's correlation coefficient. Variance inflation and condition index were also used to assess multicollinearity.
Results: Gross and histomorphological evaluation of SVs did not show any abnormality. Macronutrients (plasma protein, glucose, and cholesterol) showed non-significant (p>0.05) variation between groups. The SC and SV weight varied significantly (p<0.05) with a significant positive relationship with plasma testosterone, SV protein, fructose, and citric acid. In addition, testosterone concentration also showed increasing trend from Groups I to III but increased significantly (p<0.05) from Group II to III with positive and significant correlations with SV protein, fructose, and citric acid similar to SV weight and SC. Binders of sperm protein (BSP1, 3, and 5) genes (full length) were sequenced and established an evolutionary relationship which is lacking in buffalo.
Conclusion: The present findings established a significant positive correlation of SC with that of other fertility parameters related to SVs weight and its secretions: Fructose, citric acid, and protein (inclusive of BSPs sequenced full length), and testosterone. Therefore, the present integrated approach along with certain semen quality attributes reflecting epididymis function could be used as a predictive fertility marker for grading and selection of breeding bulls and their progenies to develop outstanding bull mother farm.
Keywords: male buffalo, morphology, scrotal circumference, seminal vesicles, sequencing, testosterone.

Friday, 1 June 2018

Calculate of withdrawal times of clenbuterol in goats to obtain safe times of slaughter

Research (Published online: 01-06-2018)
1. Calculate of withdrawal times of clenbuterol in goats to obtain safe times of slaughter
Lazuardi Mochamad, Bambang Hermanto and T. I. Restiadi
Veterinary World, 11(6): 731-738
ABSTRACT
Background and Aim: Clenbuterol as a β2-agonist drug was investigated according to the concentration of the drug available in the bodies of goats and according to the level of sensitivity of the instruments used for detection. The objective of the current study was to determine withdrawal times after giving a therapeutic dose that resulted in safe slaughters.
Materials and Methods: Five healthy male goats with a mean body weight of 20.64 kg were treated with a single dose of 5.10-3 mg/kg in the BW onto jugular vein. Whole blood samples of approximately 5 mL were taken in a time series at 5, 30, 60, 90, 150, 210, 270, 390, 510, 630, and 750 min. At 24 h posttreatment, all subjects were sacrificed, and 300 g samples of the liver were obtained. The plasma concentration and liver residue of the drug were observed by reverse-phase high-performance liquid chromatography.
Results: The drug reached a maximum concentration of 19.233±0.331 μg/mL at 5 min, and the elimination half-life was at 173.25 min. The limit detection was obtained at 0.053 μg/mL. A one-way analysis of variance between all goats showed that elimination of the clenbuterol in their bodies was similar (p=1.00), with a withdrawal time of 1,479.326 min and no residues in the liver (p<0.05).
Conclusion: Safe times for slaughter were determined to be at 2 days, 13 h, and 12 min as the 2nd safety factor (SF) time and 3 days, 1 h, and 58 min as the 3rd SF time with the liver organ free from residue.
Keywords: elimination half-life, new method for calculating withdrawal time, prescriptions for obtained β2-agonist, residues in liver.

Wednesday, 30 May 2018

Probiotic white cheese production using coculture with Lactobacillus species isolated from traditional cheeses

Research (Published online: 30-05-2018)
23. Probiotic white cheese production using coculture with Lactobacillus species isolated from traditional cheeses
A. Ehsani, M. Hashemi, A. Afshari and M. Aminzare
Veterinary World, 11(5): 726-730
ABSTRACT
Aim: The aim of the present study was to investigate the viability of lactic acid bacteria isolated from traditional cheeses and cocultured in Iranian white cheese during ripening.
Materials and Methods: A total of 24 samples were isolated from 8 types of traditional cheeses in West Azerbaijan, Iran. Isolated species were cocultured with starter bacteria during the production of Iranian white cheese, and their viability was investigated up to 60 days of the refrigerated storage.
Results: Of 118 isolates of Lactobacillus, 73 isolates (62%) were confirmed as facultative heterofermentative and 45 isolates (38%) as obligate homofermentative. Of the facultative heterofermentatives, 28 isolates (24%) were Lactobacillus plantarum, 24 isolates (20%) were Lactobacillus casei, and 21 isolates (18%) were Lactobacillus agilis. Obligate homofermentatives were Lactobacillus delbrueckii (21%), Lactobacillus helveticus (14%), and Lactobacillus salivarius (3%). L. plantarumL. casei and L. helveticus were found in high enough levels (106 CFU/g).
Conclusion: According to the obtained data, it is recommended that complex starters such as L. helveticusL. plantarum, and L. casei can be used in industrial productions of cheese to obtain exclusive properties of traditional cheeses.
Keywords: heterofermentative, Lactobacillus, probiotic, starter, traditional cheeses.

Tuesday, 29 May 2018

The improvement of eggs quality of Mojosari duck (Anas javanica) with soybean husk fermentation using cellulolytic bacteria of Spodoptera litura

Research (Published online: 29-05-2018)
22. The improvement of eggs quality of Mojosari duck (Anas javanica) with soybean husk fermentation using cellulolytic bacteria of Spodoptera litura
Sri Hidanah, Dady Soegianto Nazar and Erma Safitri
Veterinary World, 11(5): 720-725
ABSTRACT
Aim: This study was aimed to improve the quality of the eggs of Mojosari duck (Anas javanica) through complete feeding containing soybean husk was fermented using cellulolytic bacteria of Spodoptera litura.
Materials and Methods: This study consisted of three stages: The first stages, isolation and identification of cellulolytic bacteria from S. litura; the second stage, the fermentation of soybean husk through the application of bacterial cellulolytic isolate from the first stage; and the third stage, the application of the best complete feed formulation from the second stage to Mojosari duck.
Results: There are four dominant bacteria: Bacillus sp., Cellulomonas sp., Pseudomonas sp., and Cytophaga sp. Furthermore, the best reduction of the crude fiber of soybean husks is the use of Cellulomonas sp. bacteria. The final of the study, the quality of the eggs of Anas javanica, was improved, as indicated by cholesterol decrease from the yolk without the decrease of egg weight and eggshell thickness, although the decrease in egg yolk color was inevitable.
Conclusion: Soy husk fermentation using cellulolytic bacteria of S. litura was added to complete feeding can be performed to improve the quality of the eggs of Mojosari duck.
Keywords: cellulolytic bacteria, eggs quality of duck, soybean husk fermentation, Spodoptera litura.

Monday, 28 May 2018

Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period

Research (Published online: 28-05-2018)
21. Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period
A. Allaoui, B. Safsaf, M. Tlidjane, I. Djaalab and H. Djaalab Mansour
Veterinary World, 11(5): 712-719
ABSTRACT
Aim: The aim of the study was to assess the effect of two levels of wasted date (WD) by replacing commercial concentrate on the reproductive performance of Ouled Djellal (OD) rams.
Materials and Methods: Eighteen mature (2-year-old) OD rams were equally allocated to three groups and fed during 11 weeks with one of three different experimental diets, that contained 0% (0 WD), 50% (50 WD), or 75% (75 WD) of WDs in concentrate diet. Live body weight (LBW), body condition scoring (BCS), scrotal circumference (SC), testicular weight (TW), sperm production and quality, plasma testosterone concentration (T), and sexual behavior (reaction time and number of mounts with ejaculation) were regularly recorded from every ram.
Results: LBW, SC, and TW changed significantly among diet groups and during the experimental period (p<0.001), the highest averages were recorded in (0 WD) group. LBW, BCS, SC, TW, semen volume, and percentage of the positive hypo-osmotic swelling test were (p<0.001) positively influenced by flushing period. Nevertheless, sperm concentration showed a significant (p<0.001) decrease at day 30, followed by a return to the initial values afterward. There were no differences (p>0.05) between diet groups for plasma testosterone concentration and semen attributes, except that (50 WD) group expressed the lowest overall value of semen concentration. Furthermore, neither time nor diet affected (p>0.05) sperm motility and reproductive behavior parameters.
Conclusion: It is possible to introduce WD as unconventional local feeding resources in flushing diet of breeding rams without disturbing their reproductive performance.
Keywords: body weight, flushing period, rams, semen, wasted date.

Sunday, 27 May 2018

The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm

Research (Published online: 27-05-2018)
20. The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm
Tippawan Jantafong, Sakchai Ruenphet, Darsaniya Punyadarsaniya and Kazuaki Takehara
Veterinary World, 11(5): 706-711
ABSTRACT
Aim: The aim of this study was to determine the effectiveness of the fourth-generation quaternary ammonium compounds, didecyl dimethyl ammonium bromide (DDAB), on the efficacy of bacterial and viral decontamination against pathogens commonly found in livestock industry including Salmonella infantis (SI), Escherichia coli, and avian influenza virus (AIV).
Materials and Methods: The DDAB was prepared at 500, 250, and 125 parts per million (ppm) for absent and present organic material. Meanwhile, 5% of fetal bovine serum in DDAB solution sample was used to mimic the presence of organic material contamination. 400 μl of each DDAB concentration was mixed with 100 μl of each pathogen (SI, E. coli, and AIV) and then incubated at room temperature or 4°C at various time points (5 s, 30 s, 1 min, 5 min, 10 min, 15 min, and 30 min). The activity of DDAB treatment was stopped using 500 μl of FBS. Each treatment sample was titrated on either deoxycholate hydrogen sulfide lactose agar plates or Madin-Darby canine kidney cells for bacteria and AIV, respectively. Each treatment was conducted in triplicates, and the pathogen inactivation was considered effective when the reduction factor was ≥ 3 log10.
Results: Our current study revealed that the DDAB inactivated SI, E. coli, and AIV under the various concentrations of DDAB, organic material conditions, exposure temperature, and exposure timing. In addition, the comparison of bactericidal and virucidal efficacy indicated that bacteria were more susceptible to be inactivated by DDAB as compared to viruses. However, DDAB showed marked inactivated differences in the absence or presence of organic materials.
Conclusion: The DDAB may be a potential disinfectant for inactivating bacteria and viruses, especially enveloped viruses, in livestock farms. It can be useful as a disinfectant for biosecurity enhancement on and around animal farm.
Keywords: bactericidal, didecyl dimethyl ammonium bromide, disinfectant, quaternary ammonium compound, virucidal.

Saturday, 26 May 2018

Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran

Research (Published online: 26-05-2018)
19. Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran
Hadi Mirahmadi, Nasrin Rezaee, Ahmad Mehravaran, Peyman Heydarian and Saber Raeghi
Veterinary World, 11(5): 700-705
ABSTRACT
Aim: Cutaneous leishmaniasis (CL) is one of the most important health problems that are capable of involving both tropical and subtropical areas, especially in Iran. This cross-sectional study aimed to differentiate the species that are able to cause CL in Zahedan city by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.
Materials and Methods: It was conducted on 145 suspected CL patients in Zahedan city between 2014 and 2016. The smears were initially prepared, air-dried, fixed with absolute methanol, and stained with 10% Giemsa. Then, we examined the stained samples by a light microscope under 1000× magnifications. PCR assay targeted cytochrome b (cyt b) gene using LCBF1 and LCBR2 primers and the products digested by Ssp1 enzymes.
Results: From 145 suspected CL patients, 76 (52.4%) were positive in microscopic examination. In addition, we detected gene of interest (cyt b) in 98 (67.5%). The results of PCR-RFLP indicated that 53/98 (54%) cases were Leishmania major and 45/98 (46%) were Leishmania tropica, and the main species in these areas was L. major.
Conclusion: We concluded that the microscopic examination is not sensitive enough and is not able to distinguish between different Leishmania species. Instead, molecular methods like PCR-RFLP can be appropriately used with promising results.
Keywords: cytochrome bLeishmania majorLeishmania tropica, polymerase chain reaction-restriction fragment length polymorphism.

Friday, 25 May 2018

Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Research (Published online: 25-05-2018)
18. Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm
Foukpe Zhairath Adambi Boukari, Ibrahim Traore Alkoiret, Soumanou Seibou Toleba, Athanase Ahissou, Fataou Zacharie Toure, Aliyassou Mama Yacoubou, Gabriel Assouan Bonou, Ignace Ogoudanan Dotche, Victoire Akpaki and Issaka Youssao Abdou Karim
Veterinary World, 11(5): 693-699
ABSTRACT
Aim: The current study aims to evaluate the reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm.
Materials and Methods: Semen from exotic breeds was used to inseminate 70 Borgou cows on induced estrus with the norgestomet implant and 285 others on natural estrous. Data on the reproductive performances of inseminated cows were collected.
Results: In inseminated cows on induced estrus, the pregnancy rate was 30% and that of abortion was 9.52%. The fertility rate was 28.57% and those of live births and mortality were, respectively, 105.26% and 5% in these cows. As for inseminated cows on natural estrus, the pregnancy rate was 75.79% and the one of calving was 88.89%. The fertility rate recorded with natural estrous was 66.67% and was significantly higher than the one recorded with insemination on induced estrus. The live births and the birth-weaning mortality rates were, respectively, 98.96% and 11.58% in inseminated cows on natural estrus.
Conclusion: Reproductive performances are better in Borgou cows inseminated on natural estrus than in those inseminated on induced estrus.
Keywords: artificial insemination, Benin, cattle, reproductive performances.

Thursday, 24 May 2018

Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Research (Published online: 24-05-2018)
17. Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships
Khumaji Badaji Kataviya, Bharat Parmar, Ramesh Patel, Pranab Jyoti Das, Vivek Kumar, Amit Mahajan, Ravinder Singh, Devesh Thakur, Amol Kinhekar, R. K. Ravikumar and Vipin Kumar
Veterinary World, 11(5): 687-692
ABSTRACT
Aim: This study was conducted to demonstrate the acaricide efficacy of novel indigenous veterinary medication shared by an outstanding knowledge holder against naturally infested cattle and efforts in mainstreaming such wisdom.
Materials and Methods: An indigenous herbal medication in control of tick infestation was documented, and experimentation was held against naturally affected cattle. Eighteen clinically infested cattle population comprising 16 crossbred and 2 non-descript cattle were purposively selected. Majority of them were adult females, reported with a higher incidence of tick at Veterinary institution. The average pre-treatment tick count at 24 sites of observations among these animals was 18.91±2.04 (Mean [x̄]±standard error [SE]). The medication was topically applied once daily for 2 days and post-treatment observations were recorded for an experimental period of 14 days' duration.
Results: During 24-h post-treatment observation, the medication had shown 92.95% acaricidal property with clinically irrelevant rate of tick infestation of 1.33±0.39 (x̄±SE) was noticed before application of subsequent (second) dosage. This practice was found significantly effective at 5% level of significance (t0.05, 23=9.08) illustrating faster relief to livestock. Animals were treated with herbal medication as per dosage on the second day and no reinfestation was noticed up to 14 days of experimental observation.
Conclusion: The study strengthens the belief that indigenous herbal acaricide can facilitate quality livestock service at geographically distant locations. These medications can provide quicker relief, minimize tick resistance and are favorable to the environment.
Keywords: acaricide, indigenous, institution, livestock, ruminant, tick.

Wednesday, 23 May 2018

Cryptosporidiosis: A zoonotic disease concern

Review (Published online: 23-05-2018)
16. Cryptosporidiosis: A zoonotic disease concern
Natapol Pumipuntu and Supawadee Piratae
Veterinary World, 11(5): 681-686
ABSTRACT
Cryptosporidiosis is considered to be a crucial zoonotic disease caused by worldwide distributing parasitic protozoa called Cryptosporidium spp. Cryptosporidiosis becomes a major public health and veterinary concern by affecting in human and various host range species of animals. Essentially, its importance of infection is increasing because of the high incidence in young children, immunocompromised persons, or immunodeficiency syndrome patients, especially in HIV/AIDS, and it is also one of the most causes of mortality in those patients who infected with Cryptosporidium spp. as well as young animals. All domestic animal, livestock, wildlife, and human can be potential reservoirs that contribute Cryptosporidium spp. to food and surface waters and transmitted to other hosts through fecal-oral route. The oocyst stage of Cryptosporidiumspp. can remain infective and resistant to various environmental exposure and also resistant to many general disinfecting agents including chlorination which normally used in water treatment. Therefore, the understanding of these zoonotic pathogens is very essential in both animal and human health. This review focuses on the biology, life cycle, transmission, diagnosis, treatment, prevention, and control of this protozoan infection to emphasize and remind as the significant One Health problem.
Keywords: cryptosporidiosis, diarrhea, waterborne disease, zoonosis.

Tuesday, 22 May 2018

Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

Research (Published online: 22-05-2018)
15. Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress
K. T. Biobaku, T. O. Omobowale, Ahmed O. Akeem, A. Aremu, N. Okwelum and A. S. Adah
Veterinary World, 11(5): 674-680
ABSTRACT
Aim: The study determined the effect of ascorbic acid (administered orally and intramuscularly) in short-term transportation stress.
Materials and Methods: Twenty-four apparently healthy Kalahari goats were grouped into four groups (A, B, C, and D) of 6 animals each: Group A - untreated and unexposed to stress; Group B - treated with 200 mg/kg Vitamin C orally and exposed to 2 h transportation stress; Group C - treated with Vitamin C 200 mg/kg intramuscularly and exposed to 2 h transportation stress; and Group D - untreated and exposed to 2 h transportation stress. The animals were stocked using standards stipulated by the Nigerian Animal Disease Control Act and transported at 40 km/h. Cortisol and interleukin-6 (IL-6) were assayed using quantitative sandwich ELISA. Classical stress hematological parameters and antioxidative stress markers such as glutathione s-transferase, superoxide dismutase, and malondialdehyde were determined. Heart rate variability (HRV) was also assessed.
Results: The route of ascorbic acid administration did not influence the expression of IL-6, and changes in cortisol surge, antioxidative stress markers, and other hematological parameters in Kalahari goats though Group C goats showed higher HRV values (p<0.05) than others. This gives credence to the enhanced cardiac responsiveness and stress survivability in Kalahari goats.
Conclusion: Both routes could be used in the administration of ascorbic acid. Kalahari goats exposed to short-term stress; however, the intramuscular route had better heart variability and thus improved the survivability of the animals.
Keywords: ascorbic acid, intramuscular, oral, Kalahari goats, stress.

Monday, 21 May 2018

Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

Research (Published online: 21-05-2018)
14. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs
S. R. Eman, A. A. Kubesy, T. A. Baraka, F. A. Torad, I. S. Shaymaa and Faten F. Mohammed
Veterinary World, 11(5): 667-673
ABSTRACT
Aim: This study was performed to evaluate the diagnostic value of hepatocyte-derived microRNA (miRNA)-122 in acute and chronic hepatitis of dogs.
Materials and Methods: A total of 26 dogs presented at Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Cairo University, 16 dogs out of 26 showing clinical signs of hepatic insufficiency were subjected to clinical, ultrasonographic, hematobiochemical and ultrasound-guided fine-needle biopsy for cytological and histopathological investigations. On the basis of these results, 7 dogs out of 16 dogs were found to be suffering from acute hepatitis and 9 dogs suffering from chronic hepatitis. 10 clinically healthy dogs were kept as control. Serum hepatocyte-derived miRNA-122 was analyzed by real-time quantitative polymerase chain reaction in all dogs.
Results: The dogs suffering from acute hepatitis manifested jaundice, vomiting, and depression while dogs with chronic hepatitis manifested anorexia, abdominal distension, weight loss, and melena. Hematological parameters showed normocytic normochromic anemia and thrombocytopenia in both acute and chronic hepatitis groups. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total bilirubin were significantly higher than control values in acute hepatitis. In chronic hepatitis, total protein and albumin were significantly lower than control values with normal ALT, AST, ALP, and gamma-glutamyltransferase values. Ultrasonography revealed a diffuse decrease in hepatic echogenicity in acute hepatitis while the increase in hepatic echogenicity and anechoic ascetic fluid in chronic hepatitis. Cytology revealed hepatic vacuolar degeneration and histopathology revealed necrosis and apoptosis of hepatocyte in acute hepatitis while revealed massive fibrous tissue proliferation in hepatic parenchyma in chronic hepatitis. Serum miRNA-122 analysis, normalized for glyceraldehyde-3- phosphate dehydrogenase expression revealed a significant increase in acute hepatitis accompanied with elevation in ALT and AST, while in chronic hepatitis, elevation of serum miRNA-122 was accompanied with ALT and AST of the normal range.
Conclusion: Serum hepatocyte-derived miRNA-122 is of diagnostic value and highly stable blood indicator for the detection of hepatocellular injury in dogs than aminotransferases, especially in cases where aminotransferases do not exceed normal serum level.
Keywords: canine, cytology and histopathology, hepatitis, hepatocyte derived miRNA-122, ultrasonography.

Sunday, 20 May 2018

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)
13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms
Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti
Veterinary World, 11(5): 657-666
ABSTRACT
Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.
Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.
Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.
Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.
Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Saturday, 19 May 2018

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)
12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization
Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior
Veterinary World, 11(5): 649-656
ABSTRACT
Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.
Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.
Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.
Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.
Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.

Thursday, 17 May 2018

Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Research (Published online: 18-05-2018)
11. Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand
Suppada Kananub, Wassana Jawjaroensri, John VanLeeuwen, Henrik Stryhn and Pipat Arunvipas
Veterinary World, 11(5): 642-648
ABSTRACT
Aim: The study was to determine seasonal fluctuations and non-nutritional factors associated with bulk tank milk urea nitrogen (BTMUN).
Materials and Methods: A total of 58,364 BTM testing records were collected from 2364 farms in Central Thailand during September 2014-August 2015. Using square root BTMUN as the outcome, other milk components, farm effect, and sampling time were analyzed by univariable repeated measures linear regression, and significant variables were included in multivariable repeated measures linear regression.
Results: The average BTMUN (standard deviation) was 4.71 (±1.16) mmol/L. In the final model, BTM fat and protein percentages were associated with BTMUN as quadratic and cubic polynomials, respectively. BTM lactose percentage and the natural logarithm of somatic cell counts were negatively linearly associated with BTMUN. At the farm level, the BTM lactose association was negatively linear; herd BTMUN decreased following an increase of herd lactose average, and BTM lactose slopes were quite different among farms as well. Sampling time had the highest potency for the estimation of BTMUN over time, with lows and highs occurring in August and October, respectively. The variation in test level BTMUN was decreased by 18.6% compared to the null model, and 6% of the variance could be explained at the farm level.
Conclusion: The results clarify seasonal variation in BTMUN and the relationships among other BTM constituents and BTMUN, which may be useful for understanding how to manage lactating dairy cattle better to keep BTM constituents within normal ranges.
Keywords: bulk tank milk urea nitrogen, farm level, non-nutritional factor, Thailand.