Monday, 28 May 2018

Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period

Research (Published online: 28-05-2018)
21. Effect of increasing levels of wasted date palm in concentrate diet on reproductive performance of Ouled Djellal breeding rams during flushing period
A. Allaoui, B. Safsaf, M. Tlidjane, I. Djaalab and H. Djaalab Mansour
Veterinary World, 11(5): 712-719
ABSTRACT
Aim: The aim of the study was to assess the effect of two levels of wasted date (WD) by replacing commercial concentrate on the reproductive performance of Ouled Djellal (OD) rams.
Materials and Methods: Eighteen mature (2-year-old) OD rams were equally allocated to three groups and fed during 11 weeks with one of three different experimental diets, that contained 0% (0 WD), 50% (50 WD), or 75% (75 WD) of WDs in concentrate diet. Live body weight (LBW), body condition scoring (BCS), scrotal circumference (SC), testicular weight (TW), sperm production and quality, plasma testosterone concentration (T), and sexual behavior (reaction time and number of mounts with ejaculation) were regularly recorded from every ram.
Results: LBW, SC, and TW changed significantly among diet groups and during the experimental period (p<0.001), the highest averages were recorded in (0 WD) group. LBW, BCS, SC, TW, semen volume, and percentage of the positive hypo-osmotic swelling test were (p<0.001) positively influenced by flushing period. Nevertheless, sperm concentration showed a significant (p<0.001) decrease at day 30, followed by a return to the initial values afterward. There were no differences (p>0.05) between diet groups for plasma testosterone concentration and semen attributes, except that (50 WD) group expressed the lowest overall value of semen concentration. Furthermore, neither time nor diet affected (p>0.05) sperm motility and reproductive behavior parameters.
Conclusion: It is possible to introduce WD as unconventional local feeding resources in flushing diet of breeding rams without disturbing their reproductive performance.
Keywords: body weight, flushing period, rams, semen, wasted date.

Sunday, 27 May 2018

The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm

Research (Published online: 27-05-2018)
20. The study of effect of didecyl dimethyl ammonium bromide on bacterial and viral decontamination for biosecurity in the animal farm
Tippawan Jantafong, Sakchai Ruenphet, Darsaniya Punyadarsaniya and Kazuaki Takehara
Veterinary World, 11(5): 706-711
ABSTRACT
Aim: The aim of this study was to determine the effectiveness of the fourth-generation quaternary ammonium compounds, didecyl dimethyl ammonium bromide (DDAB), on the efficacy of bacterial and viral decontamination against pathogens commonly found in livestock industry including Salmonella infantis (SI), Escherichia coli, and avian influenza virus (AIV).
Materials and Methods: The DDAB was prepared at 500, 250, and 125 parts per million (ppm) for absent and present organic material. Meanwhile, 5% of fetal bovine serum in DDAB solution sample was used to mimic the presence of organic material contamination. 400 μl of each DDAB concentration was mixed with 100 μl of each pathogen (SI, E. coli, and AIV) and then incubated at room temperature or 4°C at various time points (5 s, 30 s, 1 min, 5 min, 10 min, 15 min, and 30 min). The activity of DDAB treatment was stopped using 500 μl of FBS. Each treatment sample was titrated on either deoxycholate hydrogen sulfide lactose agar plates or Madin-Darby canine kidney cells for bacteria and AIV, respectively. Each treatment was conducted in triplicates, and the pathogen inactivation was considered effective when the reduction factor was ≥ 3 log10.
Results: Our current study revealed that the DDAB inactivated SI, E. coli, and AIV under the various concentrations of DDAB, organic material conditions, exposure temperature, and exposure timing. In addition, the comparison of bactericidal and virucidal efficacy indicated that bacteria were more susceptible to be inactivated by DDAB as compared to viruses. However, DDAB showed marked inactivated differences in the absence or presence of organic materials.
Conclusion: The DDAB may be a potential disinfectant for inactivating bacteria and viruses, especially enveloped viruses, in livestock farms. It can be useful as a disinfectant for biosecurity enhancement on and around animal farm.
Keywords: bactericidal, didecyl dimethyl ammonium bromide, disinfectant, quaternary ammonium compound, virucidal.

Saturday, 26 May 2018

Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran

Research (Published online: 26-05-2018)
19. Detection of species and molecular typing of Leishmania in suspected patients by targeting cytochrome b gene in Zahedan, southeast of Iran
Hadi Mirahmadi, Nasrin Rezaee, Ahmad Mehravaran, Peyman Heydarian and Saber Raeghi
Veterinary World, 11(5): 700-705
ABSTRACT
Aim: Cutaneous leishmaniasis (CL) is one of the most important health problems that are capable of involving both tropical and subtropical areas, especially in Iran. This cross-sectional study aimed to differentiate the species that are able to cause CL in Zahedan city by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.
Materials and Methods: It was conducted on 145 suspected CL patients in Zahedan city between 2014 and 2016. The smears were initially prepared, air-dried, fixed with absolute methanol, and stained with 10% Giemsa. Then, we examined the stained samples by a light microscope under 1000× magnifications. PCR assay targeted cytochrome b (cyt b) gene using LCBF1 and LCBR2 primers and the products digested by Ssp1 enzymes.
Results: From 145 suspected CL patients, 76 (52.4%) were positive in microscopic examination. In addition, we detected gene of interest (cyt b) in 98 (67.5%). The results of PCR-RFLP indicated that 53/98 (54%) cases were Leishmania major and 45/98 (46%) were Leishmania tropica, and the main species in these areas was L. major.
Conclusion: We concluded that the microscopic examination is not sensitive enough and is not able to distinguish between different Leishmania species. Instead, molecular methods like PCR-RFLP can be appropriately used with promising results.
Keywords: cytochrome bLeishmania majorLeishmania tropica, polymerase chain reaction-restriction fragment length polymorphism.

Friday, 25 May 2018

Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm

Research (Published online: 25-05-2018)
18. Reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm
Foukpe Zhairath Adambi Boukari, Ibrahim Traore Alkoiret, Soumanou Seibou Toleba, Athanase Ahissou, Fataou Zacharie Toure, Aliyassou Mama Yacoubou, Gabriel Assouan Bonou, Ignace Ogoudanan Dotche, Victoire Akpaki and Issaka Youssao Abdou Karim
Veterinary World, 11(5): 693-699
ABSTRACT
Aim: The current study aims to evaluate the reproductive performances of the Borgou cow inseminated on natural or induced estrus with semen from Gir and Girolando at the Okpara Breeding Farm.
Materials and Methods: Semen from exotic breeds was used to inseminate 70 Borgou cows on induced estrus with the norgestomet implant and 285 others on natural estrous. Data on the reproductive performances of inseminated cows were collected.
Results: In inseminated cows on induced estrus, the pregnancy rate was 30% and that of abortion was 9.52%. The fertility rate was 28.57% and those of live births and mortality were, respectively, 105.26% and 5% in these cows. As for inseminated cows on natural estrus, the pregnancy rate was 75.79% and the one of calving was 88.89%. The fertility rate recorded with natural estrous was 66.67% and was significantly higher than the one recorded with insemination on induced estrus. The live births and the birth-weaning mortality rates were, respectively, 98.96% and 11.58% in inseminated cows on natural estrus.
Conclusion: Reproductive performances are better in Borgou cows inseminated on natural estrus than in those inseminated on induced estrus.
Keywords: artificial insemination, Benin, cattle, reproductive performances.

Thursday, 24 May 2018

Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships

Research (Published online: 24-05-2018)
17. Improvising livestock service in hilly regions through indigenous wisdom towards control of tick infestation: Institutional relationships
Khumaji Badaji Kataviya, Bharat Parmar, Ramesh Patel, Pranab Jyoti Das, Vivek Kumar, Amit Mahajan, Ravinder Singh, Devesh Thakur, Amol Kinhekar, R. K. Ravikumar and Vipin Kumar
Veterinary World, 11(5): 687-692
ABSTRACT
Aim: This study was conducted to demonstrate the acaricide efficacy of novel indigenous veterinary medication shared by an outstanding knowledge holder against naturally infested cattle and efforts in mainstreaming such wisdom.
Materials and Methods: An indigenous herbal medication in control of tick infestation was documented, and experimentation was held against naturally affected cattle. Eighteen clinically infested cattle population comprising 16 crossbred and 2 non-descript cattle were purposively selected. Majority of them were adult females, reported with a higher incidence of tick at Veterinary institution. The average pre-treatment tick count at 24 sites of observations among these animals was 18.91±2.04 (Mean [x̄]±standard error [SE]). The medication was topically applied once daily for 2 days and post-treatment observations were recorded for an experimental period of 14 days' duration.
Results: During 24-h post-treatment observation, the medication had shown 92.95% acaricidal property with clinically irrelevant rate of tick infestation of 1.33±0.39 (x̄±SE) was noticed before application of subsequent (second) dosage. This practice was found significantly effective at 5% level of significance (t0.05, 23=9.08) illustrating faster relief to livestock. Animals were treated with herbal medication as per dosage on the second day and no reinfestation was noticed up to 14 days of experimental observation.
Conclusion: The study strengthens the belief that indigenous herbal acaricide can facilitate quality livestock service at geographically distant locations. These medications can provide quicker relief, minimize tick resistance and are favorable to the environment.
Keywords: acaricide, indigenous, institution, livestock, ruminant, tick.

Wednesday, 23 May 2018

Cryptosporidiosis: A zoonotic disease concern

Review (Published online: 23-05-2018)
16. Cryptosporidiosis: A zoonotic disease concern
Natapol Pumipuntu and Supawadee Piratae
Veterinary World, 11(5): 681-686
ABSTRACT
Cryptosporidiosis is considered to be a crucial zoonotic disease caused by worldwide distributing parasitic protozoa called Cryptosporidium spp. Cryptosporidiosis becomes a major public health and veterinary concern by affecting in human and various host range species of animals. Essentially, its importance of infection is increasing because of the high incidence in young children, immunocompromised persons, or immunodeficiency syndrome patients, especially in HIV/AIDS, and it is also one of the most causes of mortality in those patients who infected with Cryptosporidium spp. as well as young animals. All domestic animal, livestock, wildlife, and human can be potential reservoirs that contribute Cryptosporidium spp. to food and surface waters and transmitted to other hosts through fecal-oral route. The oocyst stage of Cryptosporidiumspp. can remain infective and resistant to various environmental exposure and also resistant to many general disinfecting agents including chlorination which normally used in water treatment. Therefore, the understanding of these zoonotic pathogens is very essential in both animal and human health. This review focuses on the biology, life cycle, transmission, diagnosis, treatment, prevention, and control of this protozoan infection to emphasize and remind as the significant One Health problem.
Keywords: cryptosporidiosis, diarrhea, waterborne disease, zoonosis.

Tuesday, 22 May 2018

Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress

Research (Published online: 22-05-2018)
15. Use of goat interleukin-6, cortisol, and some biomarkers to evaluate clinical suitability of two routes of ascorbic acid administration in transportation stress
K. T. Biobaku, T. O. Omobowale, Ahmed O. Akeem, A. Aremu, N. Okwelum and A. S. Adah
Veterinary World, 11(5): 674-680
ABSTRACT
Aim: The study determined the effect of ascorbic acid (administered orally and intramuscularly) in short-term transportation stress.
Materials and Methods: Twenty-four apparently healthy Kalahari goats were grouped into four groups (A, B, C, and D) of 6 animals each: Group A - untreated and unexposed to stress; Group B - treated with 200 mg/kg Vitamin C orally and exposed to 2 h transportation stress; Group C - treated with Vitamin C 200 mg/kg intramuscularly and exposed to 2 h transportation stress; and Group D - untreated and exposed to 2 h transportation stress. The animals were stocked using standards stipulated by the Nigerian Animal Disease Control Act and transported at 40 km/h. Cortisol and interleukin-6 (IL-6) were assayed using quantitative sandwich ELISA. Classical stress hematological parameters and antioxidative stress markers such as glutathione s-transferase, superoxide dismutase, and malondialdehyde were determined. Heart rate variability (HRV) was also assessed.
Results: The route of ascorbic acid administration did not influence the expression of IL-6, and changes in cortisol surge, antioxidative stress markers, and other hematological parameters in Kalahari goats though Group C goats showed higher HRV values (p<0.05) than others. This gives credence to the enhanced cardiac responsiveness and stress survivability in Kalahari goats.
Conclusion: Both routes could be used in the administration of ascorbic acid. Kalahari goats exposed to short-term stress; however, the intramuscular route had better heart variability and thus improved the survivability of the animals.
Keywords: ascorbic acid, intramuscular, oral, Kalahari goats, stress.

Monday, 21 May 2018

Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs

Research (Published online: 21-05-2018)
14. Evaluation of hepatocyte-derived microRNA-122 for diagnosis of acute and chronic hepatitis of dogs
S. R. Eman, A. A. Kubesy, T. A. Baraka, F. A. Torad, I. S. Shaymaa and Faten F. Mohammed
Veterinary World, 11(5): 667-673
ABSTRACT
Aim: This study was performed to evaluate the diagnostic value of hepatocyte-derived microRNA (miRNA)-122 in acute and chronic hepatitis of dogs.
Materials and Methods: A total of 26 dogs presented at Veterinary Teaching Hospital, Faculty of Veterinary Medicine, Cairo University, 16 dogs out of 26 showing clinical signs of hepatic insufficiency were subjected to clinical, ultrasonographic, hematobiochemical and ultrasound-guided fine-needle biopsy for cytological and histopathological investigations. On the basis of these results, 7 dogs out of 16 dogs were found to be suffering from acute hepatitis and 9 dogs suffering from chronic hepatitis. 10 clinically healthy dogs were kept as control. Serum hepatocyte-derived miRNA-122 was analyzed by real-time quantitative polymerase chain reaction in all dogs.
Results: The dogs suffering from acute hepatitis manifested jaundice, vomiting, and depression while dogs with chronic hepatitis manifested anorexia, abdominal distension, weight loss, and melena. Hematological parameters showed normocytic normochromic anemia and thrombocytopenia in both acute and chronic hepatitis groups. Alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), and total bilirubin were significantly higher than control values in acute hepatitis. In chronic hepatitis, total protein and albumin were significantly lower than control values with normal ALT, AST, ALP, and gamma-glutamyltransferase values. Ultrasonography revealed a diffuse decrease in hepatic echogenicity in acute hepatitis while the increase in hepatic echogenicity and anechoic ascetic fluid in chronic hepatitis. Cytology revealed hepatic vacuolar degeneration and histopathology revealed necrosis and apoptosis of hepatocyte in acute hepatitis while revealed massive fibrous tissue proliferation in hepatic parenchyma in chronic hepatitis. Serum miRNA-122 analysis, normalized for glyceraldehyde-3- phosphate dehydrogenase expression revealed a significant increase in acute hepatitis accompanied with elevation in ALT and AST, while in chronic hepatitis, elevation of serum miRNA-122 was accompanied with ALT and AST of the normal range.
Conclusion: Serum hepatocyte-derived miRNA-122 is of diagnostic value and highly stable blood indicator for the detection of hepatocellular injury in dogs than aminotransferases, especially in cases where aminotransferases do not exceed normal serum level.
Keywords: canine, cytology and histopathology, hepatitis, hepatocyte derived miRNA-122, ultrasonography.

Sunday, 20 May 2018

Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)
13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms
Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti
Veterinary World, 11(5): 657-666
ABSTRACT
Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.
Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.
Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.
Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.
Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Saturday, 19 May 2018

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)
12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization
Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior
Veterinary World, 11(5): 649-656
ABSTRACT
Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.
Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.
Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.
Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.
Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.