Effect of pre-supplementation with Pleurotus sajor-caju crude extracts on body weight and consequence responses of leukocytes and immune organs in fancy carp following inoculation with Aeromonas veronii

Research (Published online: 31-05-2020)

27. Effect of pre-supplementation with Pleurotus sajor-caju crude extracts on body weight and consequence responses of leukocytes and immune organs in fancy carp following inoculation with Aeromonas veronii

Sitthichon Rattanachan, Sumrarn Bunnajirakul and Darsaniya Punyadarsaniya

Veterinary World, 13(5): 1010-1016

ABSTRACT

Aim: The present study aimed at highlighting the effects of oyster mushroom (Pleurotus sajor-caju), as a dietary supplement on growth performance, differential leukocytes population, and histological changes of melanomacrophage centers (MMCs) in spleen and kidney of fancy carp on bacterial infection.

Materials and Methods: A total of 60 fancy carp were allocated into four groups according to feed formulations including; (1) basal diet with 2% crude extract of P. sajor-caju, (2) basal diet with 2% β-glucan, whereas Group 3, and Group 4 were positive and negative control, which were fed only basal diet. Diets were provided for 30 days, thereafter, fish of Group 1 to Group 3 were intraperitoneally injected with Aeromonas veronii (1.8×109 CFU), whereas Group 4 was injected with normal saline. At day 7 post-bacterial inoculation, all fish were weighed, whole blood was collected for differential white blood cell count, and two visceral organs, posterior kidney and spleen, were collected from euthanized fish to observe histological changes, particularly MMCs.

Results: No significant differences in body weight were found (p>0.05) at 1st week of the experiment; however, fish body weight was significantly increased from week 2 to week 4 of the experiment. Increased monocyte number was found in carp fish fed with the P. sajor-caju or β-glucan supplemented diets compared to the control groups (p<0.05). The proliferation of monocyte in fish was consistent with increased number and size of MMCs in hemotopoietic organs, posterior kidney and spleen, especially in fancy carp fed with of P. sajor-caju crude extract and commercially available β-glucan before bacterial inoculation in fish.

Conclusion: These findings indicate that crude polysaccharide from P. sajor-caju can be potentially used as a feed additive that might promote innate immune function in fish.

Keywords: Aeromonas veronii, body weight, fancy carp (Cyprinus carpio), immunostimulant, Pleurotus sajor-caju.

Seroprevalence of African horse sickness in selected donkey populations in Namibia

Research (Published online: 31-05-2020)

26. Seroprevalence of African horse sickness in selected donkey populations in Namibia

Umberto Molini, Guendalina Zaccaria, Erick Kandiwa, Borden Mushonga, Siegfried Khaiseb, Charles Ntahonshikira, Bernard Chiwome, Ian Baines, Oscar Madzingira, Giovanni Savini and Nicola D'Alterio

Veterinary World, 13(5): 1005-1009

ABSTRACT

Background and Aim: African horse sickness (AHS) is a non-contagious viral disease of horses and other equids caused by an arbovirus belonging to the Reoviridae family and genus Orbivirus. AHS is an endemic disease that is responsible for the death of a high number of horses every year in Namibia. At present, there is no information on the prevalence and distribution of AHS virus (AHSV) serotypes in the different regions of Namibia. Therefore, this survey aimed to fill this knowledge gap by investigating the AHSV seroprevalence in Namibian donkeys.

Materials and Methods: A total of 260 blood samples (20 samples for each region) were randomly collected from donkeys aged between 3 and 5 years. Sera were screened for AHSV-specific immunoglobulin G antibodies using a commercial competitive enzyme-linked immunosorbent assay kit and samples positive to AHSV antibodies were further tested by serum neutralization (SN) assay to evaluate the AHSV serotype-specific immune response.

Results: Seroprevalence of antibodies against AHSV in Namibian donkeys was 63.5%. The AHSV prevalence was significantly higher in the northern region (64%) than in the southern region (36%). A significantly (p<0.05) higher number of donkeys had antibodies against AHSV-6 (37.8%) and AHSV-9 (37.8%). The AHSV-2, AHSV-6, and AHSV-9 prevalence were higher (p<0.05) in the northern regions compared to the southern regions. None of the donkeys in this study, however, tested positive for AHSV-8.

Conclusion: Results of the current study indicate that all AHSV serotypes have either circulated previously or are circulating in Namibia except for AHSV-8. In particular, AHSV-1, -2, -3, -4, -5, -6, and -9 serotypes have circulated or are circulating in the northern region of Namibia, while AHSV-1, -4, -5, -6, -7, and -9 have infected donkeys in the south. AHSV-9 and AHSV-6 were the most prevalent serotypes detected in donkeys in this study. SN results showed that several donkeys from Kavango East, Kavango West, and Ohangwena regions had been exposed to multiple serotypes, indicating the possibility of cocirculation of several strains in Namibia.

Keywords: African horse sickness, donkeys, enzyme-linked immunosorbent assay, Namibia.

The effects of breed, age, sex, and body weight on electrocardiographic parameters in military working dogs

Research (Published online: 30-05-2020)

25. The effects of breed, age, sex, and body weight on electrocardiographic parameters in military working dogs

Wichaporn Lerdweeraphon, Surangkhana Thanwongsa, Suriya Youyod, Sermsawat Imsopa and Wootichai Kenchaiwong

Veterinary World, 13(5): 1001-1004

ABSTRACT

Aim: This study aimed to investigate the effects of breed, sex, age, and body weight on different electrocardiographic parameters in military working dogs (Labrador Retriever and German Shepherd).

Materials and Methods: Electrocardiographic recordings (paper speed = 25 mm/s and calibration = 10 mm/mV) were performed to obtain all the standard bipolar limb leads (leads I, II, and III) and unipolar augmented limb leads (leads aVR, aVL, and aVF). A total of 16 Labrador Retrievers and 14 German Shepherds were restrained manually in the right lateral recumbency without any tranquilizer or anesthetic drug. Amplitude and duration of P, QRS, and T wave, PR and QT interval, mean electrical axis, and heart rate were measured in each recording.

Results: There was no significant difference in electrocardiographic parameters across breed and sex. However, QRS duration tended to alter by breed (p<0.1) in Labrador Retrievers (0.04±0.005 s), which is lower than German Shepherds (0.05±0.005 s). PR interval was influenced by sex (p<0.1). PR interval was higher in females (0.13±0.005 s) than males (0.11±0.008 s). In addition, electrocardiographic values were not significantly affected by age and body weight, except that the amplitude of R wave was statistically affected by age (p<0.05). A correlation was found between the decrease in R wave amplitude and increase in age of dogs.

Conclusion: Different electrocardiographic parameters were within the normal range. A significant effect of age was seen on amplitude of R wave. However, the effect of breed, sex, and body weight was not significant on different electrocardiographic parameters in Labrador Retriever and German Shepherd dogs.

Keywords: age, breed, dogs, electrocardiogram, sex.

DNA of Brugia malayi detected in several mosquito species collected from Balangan District, South Borneo Province, Indonesia

Research (Published online: 30-05-2020)

24. DNA of Brugia malayi detected in several mosquito species collected from Balangan District, South Borneo Province, Indonesia

Supriyono Supriyono and Suriyani Tan

Veterinary World, 13(5): 996-1000

ABSTRACT

Background and Aim: Lymphatic filariasis (LF) is a lesser-known parasitic disease, which contributes to significant decreases in overall health. This study investigated the presence of Brugia malayi in mosquitoes collected in the South Borneo Province, Indonesia.

Materials and Methods: Mosquitoes were collected through bare leg collection methods after sunset in several areas of the Hukai and Gulinggang villages in the Balangan District. The collected mosquitoes were identified based on morphological features and dissected to find microfilaria and then pooled through species for polymerase chain reaction (PCR) microfilaria detection.

Results: A total of 837 female mosquitoes consisting of at least 14 species were selected; they were dissected, and no microfilariae were found. Mosquitoes were divided into 69 pools for PCR analysis. PCR revealed that 8.7% (6/69) of the pools were positive for B. malayi, including Mansonia annulifera (4 pools), Aedes albopictus (1 pool), and Culex tritaeniorhynchus (1 pool).

Conclusion: These results suggested that mosquito dissection was not an optimum method for finding microfilaria. M. annulifera, C. tritaeniorhynchus, and A. albopictus mosquitoes might play an important role in the transmission of LF in the Balangan District. Information from this study could be used for the prevention of transmission or vector control programs in Indonesia.

Keywords: Brugia malayi, lymphatic filariasis, polymerase chain reaction.

Incidence risk of bronchopneumonia in newborn calves associated with intrauterine diselementosis

Research (Published online: 29-05-2020)

23. Incidence risk of bronchopneumonia in newborn calves associated with intrauterine diselementosis

Elena Kalaeva, Vladislav Kalaev, Anton Chernitskiy, Mohammad Alhamed and Vladimir Safonov

Veterinary World, 13(5): 987-995

Background and Aim: Macro- and micro-elements are required to ensure the normal course of biochemical processes in the development of an animal's body. Any excess, deficiency, or imbalance in chemical elements in an animal's body can cause the development of various latent or clinically expressed pathological conditions. Diselementosis in pregnant cows may lead to impaired embryo and fetal development, as well as reduced neonatal viability. The aim of this study was to analyze the content of macroelements and microelements in the blood serum of both calving cows and their calves to evaluate the relationship between indicators of mineral metabolism in the mother and newborn and to establish what role separate chemical elements play in making newborn calves more prone to bronchopneumonia.

Materials and Methods: The content of potassium (K), sodium (Na), iron (Fe), Copper (Cu), Zinc (Zn), Strontium (Sr), arsenic (As), nickel (Ni), cobalt (Co), chromium (Cr), molybdenum (Mo), and selenium (Se) in the blood serum of 33 pregnant cows between 239 and 262 days of gestation and their 33 1-day old calves was determined using the Shimadzu AA6300 (Japan) atomic adsorption spectrophotometer. Calcium (Ca) and magnesium (Mg) content was determined using ion-selective electrodes from the Olympus-400 analyzer (Beckman Coulter, USA). During the 1st month of life, all calves in the sample set had some sort of respiratory diseases and seven of the calves had bronchopneumonia. Retrospectively, the samples of adult and newborn animals were divided into two groups each: Dams I – cows whose calves had uncomplicated bronchitis (n=26); Dams II – cows whose calves got bronchopneumonia (n=7); and Newborns I – calves with uncomplicated bronchitis (n=26); Newborns II – calves with bronchopneumonia (n=7).

Results: The content of Ca, Mg, K, Na, Mo, and Se in dams in both groups of cows was within the reference range; the concentrations of Fe and Ni were higher than the reference range; and the concentrations of Cu, Zn, As, Co, and Cr were lower than the reference range. There were no significant differences in elemental status between the Dams I and Dams II groups. In newborn calves, the concentration of Ca and Mo corresponded to the reference range; the concentrations of Mg, Fe, Co, and Ni in both groups exceeded the reference range; and the concentrations of Cu, Zn, As, Cr, and Se were lower than the reference range. Results highlighted that there was a tendency to decrease concentration of Fe, Mo, and Se and a significant increase in the Ni concentration in calves of the Newborns II group compared with calves of the Newborns I group. It was also found that Zn, Co, Cr, and Mo actively accumulated in the body of newborn animals while the transplacental transfer of Cu, As, and Sr was limited; and transfer of Se and Ni was regulated by concentration ratios in the blood of the mother and the fetus. The excessive concentrations of Ni and Fe in the blood serum of cows and calves and the imbalance in the ratio of elements Fe–Cu–Zn, Fe–Cu–Co negatively affected erythropoiesis, formation of the immune system, and antioxidant status of the fetus and newborn. These changes were considered to be risk factors for the development of bronchopneumonia in calves.

Conclusion: An excess of serum Fe and Ni and deficiency of Cu, Zn, As, Co, and Cr in cows during the gestation period can lead to similar impairments of the mineral status in newborn calves. At the systemic level, dyslementosis in combination with the influence of other adverse factors, can lead to an increased load on the respiratory and hematopoietic systems of calves during postnatal adaptation and can subsequently cause a decrease in the natural resistance of calves and development of bronchopneumonia.

Keywords: erythrocytes, leukocytes, macroelements, microelements, respiratory diseases.

Molecular characterization and phylogenetic analysis of fowl adenovirus serotype-4 from Guangdong Province, China

Research (Published online: 24-05-2020)

22. Molecular characterization and phylogenetic analysis of fowl adenovirus serotype-4 from Guangdong Province, China

Fu Yuming, Yuan Sheng, Deng Wenyu, Chi Shihong, Li Wenfeng, Huang Wenjing, Li Xiaowen, Saeed El-Ashram, Kun Mei, Guo Jinyue, Zhang Xuelian, Li Zhili and Huang Shujian

Veterinary World, 13(5): 981-986

ABSTRACT

Aim: Our aim in this study was to isolate potentially novel strains of fowl adenovirus serotype-4 (FAdV-4) that is currently circulating in broiler chicken flocks in Guangdong Province, China, and to compare nucleotide and amino acid (AA) sequences of their respective hexon genes.

Materials and Methods: The experiment was carried out on poultry farms experiencing outbreaks of FAdV-4-associated hydropericardium syndrome (HPS). Tissue samples from the hearts and livers of deceased chickens were screened for FAdV-4 infection using hexon gene-specific polymerase chain reaction (PCR).

Results: New virus isolates were used to infect 7-day-old chicks, which went onto reproduce typical HPS signs. The hypervariable region of the FAdV-4 hexon gene was PCR-amplified and sequenced. The hexon nucleotide and deduced AA sequence identities were 99.8-99.9% and 99.5-99.8%, respectively, among the four novel isolates. In addition, the new isolates were 97-100% and 96.4-99.9% identical to the nucleotide and deduced AA sequences, respectively, of FAdV-4 hexon genes available in the National Center for Biotechnology Information GenBank database. Phylogenetic analyses, based on the hexon gene sequence, revealed that the new isolates, clustered with FAdV-C; the FAdV-A, FAdV-B, FAdV-D, and FAdV-E viruses, were more distantly related.

Conclusion: New FAdV-4 isolates from Guangdong Province are similar to those identified in other regions of the world. This information provides critical insight into HPS epidemiology and provides a perspective for monitoring outbreaks and developing strategies for disease prevention.

Keywords: Angara disease, fowl adenovirus-4, phylogenetic analysis.

Genetic characterization and risk factors for feline hemoplasma infection in semi-domesticated cats in Bangkok, Thailand

Research (Published online: 23-05-2020)

21. Genetic characterization and risk factors for feline hemoplasma infection in semi-domesticated cats in Bangkok, Thailand

Thom Do, Ketsarin Kamyingkird, Linh Khanh Bui and Tawin Inpankaew

Veterinary World, 13(5): 975-980

ABSTRACT

Background and Aim: Stray cats are a reservoir for various zoonotic diseases relevant to public health in Thailand. The vector-borne infection, hemoplasmosis, also known as infectious anemia, is one such disease carried by domestic and wild felids. This study focuses on molecular characterization and phylogenetic analysis of hemoplasma in semi-domesticated cats in Bangkok, Thailand.

Materials and Methods: In total, 473 blood samples were collected from 53 temple communities in 34 metropolitan districts and assayed using polymerase chain reaction (PCR) to amplify partial 16S rRNA genes for hemoplasma detection. Risk factors for hemoplasma infection (gender, age, free-roaming, and ectoparasite exposure) were analyzed using Chi-square tests, logistic regression, and odds ratios (OR) with 95% confidence intervals (95% CI) using R software (version 3.6.1). A phylogenetic tree was established from genetic characterization of hemoplasmas.

Results: In total, 180 samples (38.05%) were positive for hemoplasma. Of half of the positive sequenced samples, 83.33% were infected with Candidatus Mycoplasma haemominutum (CMhm), 13.33% with Mycoplasma haemofelis (Mhf), and 3.33% with Candidatus Mycoplasma turicensis (CMt). Cats over 5 years old were more likely to be infected than younger cats (p<0.005, OR=3.8, 95% CI=1.64-4.78). Cats were diagnosed as positive based on PCR assays in 97% (33/34) of districts surveyed. The phylogenetic tree showed two majority clusters with three clades of feline hemotropic mycoplasma.

Conclusion: Overall, the survey shows the prevalence (38.05%) and distribution of feline hemoplasma in semi-domesticated cats. This information will contribute to effective prevention and control strategies to minimize infections by feline vector-borne pathogens in Thailand.

Keywords: hemoplasma, semi-domesticated cat, Thailand, vector-borne diseases.

Histopathological study and intestinal mucous cell responses against Aeromonas hydrophila in Nile tilapia administered with Lactobacillus rhamnosus GG

Research (Published online: 22-05-2020)

20. Histopathological study and intestinal mucous cell responses against Aeromonas hydrophila in Nile tilapia administered with Lactobacillus rhamnosus GG

Suchanit Ngamkala, Khomson Satchasataporn, Chanokchon Setthawongsin and Wuttinun Raksajit

Veterinary World, 13(5): 967-974

ABSTRACT

Aim: This study aimed to examine the intestinal histopathological lesions and mucous cell responses in the entire intestines of Nile tilapia administered with Lactobacillus rhamnosus GG (LGG)-mixed feed, after Aeromonas hydrophila challenge.

Materials and Methods: Intestinal samples from fish fed with control normal diet or LGG-mixed feed (1010 colony-forming unit [CFU]/g feed) with or without A. hydrophila in phosphate-buffered saline challenge (7.46 × 108 CFU/mL/fish) were collected and processed for histopathological study. The mucous cell responses were evaluated using histochemistry, using Alcian blue (AB) at pH 2.5, AB at pH 1.0, and periodic acid-Schiff-AB at pH 2.5. The quantification of the intestinal mucous cell size and the staining character of each mucin type from the entire intestine were recorded and counted.

Results: Histopathological study showed remarkable lesions only in the proximal intestine in fish infected with A. hydrophila, while LGG-fed fish had less intestinal damage, perhaps resulting from heterophil infiltration. Furthermore, a significant (p<0.01) increase in mixed mucous cell numbers was observed mainly in the proximal intestine of all challenged fish, compared with normal diet-fed fish without challenge, and also in LGG-fed fish with A. hydrophila challenge compared with LGG-fed fish without challenge.

Conclusion: Dietary LGG-fed Nile tilapia showed improvements in host innate immunity. In addition, LGG was effective in decreasing intestinal lesions from A. hydrophila-induced intestinal damage. Moreover, increasing numbers of mixed mucous cells in the proximal intestine might be indicative of certain pathological conditions in Nile tilapia after A. hydrophila infection.

Keywords: Aeromonas hydrophila, intestine, Lactobacillus rhamnosus GG, mucous cell, Nile tilapia.

Alpha-lipoic acid ameliorates sodium valproate-induced liver injury in mice

Research (Published online: 22-05-2020)

19. Alpha-lipoic acid ameliorates sodium valproate-induced liver injury in mice

Chrismawan Ardianto, Hijrawati Ayu Wardani, Nurrahmi Nurrahmi, Mahardian Rahmadi and Junaidi Khotib

Veterinary World, 13(5): 963-966

ABSTRACT

Aim: This study examines the effect of alpha-lipoic acid (ALA) on sodium valproate-induced liver injury through histological features of mice liver tissue.

Materials and Methods: Mice were divided into three groups; (1) vehicle group, (2) sodium valproate group, and (3) sodium valproate-ALA group. The vehicle group was injected with saline intraperitoneal (i.p.) for 28 days. The sodium valproate group was injected with sodium valproate 300 mg/kg, i.p. daily for 2 weeks, after which the vehicle was administered daily until day 28. The sodium valproate-ALA group was injected with sodium valproate 300 mg/kg daily for 2 weeks before the administration of ALA 100 mg/kg i.p. until day 28. The mice were euthanized, and the liver was extracted for histopathological examination.

Results: Histopathological examination of the liver section of the vehicle group showed a normal structure of the liver. Two weeks after the administration of sodium valproate, histopathological examination showed an abnormal structure of the liver, with necrotic appearance and inflammatory cells. Moreover, treatment with ALA after the administration of sodium valproate notably ameliorated hepatic histopathological lesions and the liver structure corresponded to a normal liver structure.

Conclusion: ALA ameliorates sodium valproate-induced liver injury in mice.

Keywords: alpha-lipoic acid, drug-induced liver injury, histopathological, liver injury, sodium valproate.

Comparison of canine stifle kinematic analysis after two types of total knee arthroplasty: A cadaveric study

Research (Published online: 20-05-2020)

18. Comparison of canine stifle kinematic analysis after two types of total knee arthroplasty: A cadaveric study

Chaiyakorn Thitiyanaporn, Nattapon Chantarapanich, Somchai Sompaisarnsilp and Naris Thengchaisri

Veterinary World, 13(5): 956-962

ABSTRACT

Background and Aim: Osteoarthritis is a common consequence of cranial cruciate ligament rupture (CCLR) in the canine stifle. Total knee replacement is a valuable method for managing end-stage osteoarthritis.

Materials and Methods: Two new designs of total knee replacement implants were fabricated with information from computed tomography scans. Canine hind limbs of cadavers were tested with a biomechanical testing machine with C-arm fluoroscopy. The four groups tested were as follows: Intact stifles (INTACT), CCLR, total knee arthroplasty (TKA) with a peg on top of the tibial component (TKAP), and TKA with no peg on top of the tibial component (TKAN). Extension, flexion, adduction, abduction, internal rotation, external rotation, cranial translation, caudal translation, and range of motion were measured.

Results: The cranial translation of the tibia relative to the femur increased significantly after cutting off the cranial cruciate ligament. After arthroplasty, adduction/abduction and cranial/caudal translation within the TKAN group was increased compared with the intact stifle group. In the TKAP group, only adduction was greater than it was in the intact stifle group.

Conclusion: The design of the prosthesis used for the TKAP group was more appropriate for total knee replacement in dogs than the design of the prosthesis for the TKAN group.

Keywords: cranial cruciate ligament, dogs, osteoarthritis, total knee arthroplasty.

Sperm protein markers for Holstein bull fertility at National Artificial Insemination Centers in Indonesia

Research (Published online: 20-05-2020)

17. Sperm protein markers for Holstein bull fertility at National Artificial Insemination Centers in Indonesia

Zulfi Nur Amrina Rosyada, Mokhamad Fakhrul Ulum, Ligaya I. T. A. Tumbelaka and Bambang Purwantara

Veterinary World, 13(5): 947-955

ABSTRACT

Background and Aim: Holstein cows and heifers are widely bred in Indonesia by artificial insemination (AI) to increase population and milk production. Sperm fertility is modulated by genetic factors, but the analysis of sperm quality is still based on macro- and microscopic characteristics. This study aimed to analyze both sperm quality and proteins of Holstein bulls at different fertility levels.

Materials and Methods: The frozen semen samples were collected from the Indonesia National AI Center. They were classified based on the reproductive efficiency data and were grouped into high fertile (HF) and low fertile (LF). Sperm qualities were evaluated by microscopic evaluation. The Holstein sperm proteins were extracted using phenylmethanesulfonyl fluoride as a protease inhibitor and the benzidine detergent extraction method. Discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was conducted to analyze the molecular weights (MWs) of the sperm proteins. The data obtained were analyzed by a t-test using the one-factor bull fertility level, and Spearman's correlation analysis was used to identify the correlation between the sperm microscopic evaluation parameters and protein bands.

Results: The sperm motility post-freeze thawing was not significantly different between the HF and LF (p>0.05). The HF level had a higher percentage of viability, intact plasma membrane integrity, and intact acrosomes than the LF (p<0.05). Five protein bands were found in the SDS-PAGE of sperm proteins of Holstein bulls with different concentrations. Sperm proteins with MWs of 17.51 kDa, 14.87 kDa, 33.71 kDa, and 41.97 kDa were abundant in the Holstein bulls with an HF level, while 55 kDa proteins were abundant in the LF level of Holstein bulls. The sperm of Holstein bulls in the HF level contained proteins of about 33.71 kDa that were not detected in the LF.

Conclusion: The sperm protein with a molecular weight of 33.71 kDa was predicted to be a specific protein biomarker that influences bull fertility. Sperm fertilization abilities were also determined by the sperm proteins, the morphology of sperm acrosomes, and the quality of plasma membranes. This method can be used to select bulls with high fertility to increase the population of Holstein bulls.

Keywords: biomarker, fertility, sperm proteins, bull, Holstein.

Evaluation of ensiled soy sauce by-product combined with several additives as an animal feed

Research (Published online: 19-05-2020)

16. Evaluation of ensiled soy sauce by-product combined with several additives as an animal feed

Sadarman Sadarman, Muhammad Ridla, Nahrowi Nahrowi, Roni Ridwan and Anuraga Jayanegara

Veterinary World, 13(5): 940-946

ABSTRACT

Aim: The present experiment aimed to evaluate the use of different additives, i.e., lactic acid bacteria (LAB) inoculant, tannin extract, and propionic acid, on the chemical composition, fermentative characteristics, and in vitro ruminal fermentation of soy sauce by-product (SSB) silage.

Materials and Methods: SSB was subjected to seven silage additive treatments: Fresh SSB, ensiled SSB, ensiled SSB+LAB, ensiled SSB+2% acacia tannin, ensiled SSB+2% chestnut tannin, ensiled SSB+0.5% propionic acid, and ensiled SSB+1% acacia tannin+1% chestnut tannin+0.5% propionic acid. Ensiling was performed for 30 days in three replicates, and each replicate was made in duplicate. The samples were evaluated for their chemical composition and silage fermentation characteristics and were tested in an in vitro rumen fermentation system.

Results: In general, the nutrient compositions did not differ among the tested SSBs in response to the different additives used. The addition of tannins, either acacia or chestnut, and propionic acid significantly decreased the pH of the ensiled SSB (p<0.05). The addition of several additives (except LAB) decreased the ammonia concentration in SSB silage (p<0.05). The total volatile fatty acids in the in vitro rumen fermentation profile of the ensiled SSB were not significantly altered by the various additives applied. The addition of some additives, i.e., ensiled SSB+LAB and ensiled SSB+2% acacia tannin, reduced the digestibility values of the SSB (p<0.05). Different silage additives did not significantly affect methane production, although the addition of acacia tannins tended to result in the lowest methane production among treatments.

Conclusion: The use of additives, particularly 2% acacia tannins, can reduce proteolysis in SSB silage.

Keywords: additive, feed, silage, soy sauce, tannins.

In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines

Research (Published online: 19-05-2020)

15. In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines

Bambang Pontjo Priosoeryanto, Riski Rostantinata, Eva Harlina, Waras Nurcholis, Rachmi Ridho and Lina Noviyanti Sutardi

Veterinary World, 13(5): 931-939

ABSTRACT

Background and Aim: Tumor disorder is one of the degenerative diseases that affected human and animals and recently is tend to increase significantly. The treatment of tumor diseases can be performed through surgical, chemotherapy, radiotherapy, biological substances, and herbs medicine. Typhonium flagelliforme leaves extract known to have an antiproliferation activity, while interferons (IFNs) one of the cytokines that first used as an antiviral agent was also known to have antitumor activity. Nowadays, the treatment of tumors using a traditional way, including the use of herbal substances, becomes popular. Some limitations of the antitumor activity due to resistant development of the cell to some substances were one of the problems on why the treatment of cancer was unsuccessful. This study aimed to elaborate the synergistic effect on the antiproliferation and anti-angiogenesis activities of the combinations between T. flagelliforme leaves ethanol extract and canine natural (natural canine IFN [nCaIFN]) and recombinant (recombinant canine IFN [rCaIFN]) IFNs on tumor-derived cell lines to find the new potential antitumor substances.

Materials and Methods: The extraction of T. flagelliforme leaves was performed using the maceration method and followed by phytochemical screening assays. According to the result of LC50 by the brine shrimp lethality test, the dose used for T. flagelliforme extract was 120 ppm while the dose of IFNs was 102 U/ml. The tumor-derived cell lines (canine squamous cell carcinoma [CSCC], canine mammary gland benign mixed tumor/MCM-IPB-B3, and feline squamous cell carcinoma [FSCC]) and normal rabbit endothelial cells were cultured and maintained on Dulbecco's Modified Eagle's Medium DMEM/Ham-F12 medium supplemented with 10% fetal calf serum, antibiotic, and antifungal. The antiproliferation activity was assayed by calculated the total cell number after treated with the tested substances. The antiangiogenesis assay was performed using in vitro method on rabbit normal endothelial cells and in ovo using chicken chorioallantoic membrane (CAM).

Results: The phytochemical screening test of the T. flagelliforme leaves ethanol extract indicated that the compound consisted of flavonoid, steroid, and tannin. The antiproliferation activity was increased in the combination of substances compared to the single exposure of each substance on all tested tumor-derived cell lines. There was no significantly different on the antiproliferation activity between a combination of T. flagelliforme with nCaIFN or rCaIFN in every single tested cell lines, but the comparison of this activity among the three tumor-derived cell lines seem that the antiproliferation activity is more effective on CSCC cell lines compared to the canine mammary gland benign mixed tumor and FSCC cell lines. A similar pattern of synergistic effect was also detected on the anti-angiogenesis activity in vitro using rabbit endothelial cells as well as in ovo assays. The most effective of the in vitro and in ovo anti-angiogenesis activity was observed on the combination substances between T. flagelliforme extract and rCaIFN compared to other treatments.

Conclusion: There was a synergistic effect on the antiproliferation and antiangiogenesis activities of the combination between T. flagelliforme and canine IFNs (natural and recombinant) and this result could be developed as another alternative on the cancer treatments.

Keywords: antiproliferation, antiangiogenesis, canine interferons, ethanol extract, tumor cell lines, Typhonium flagelliforme.

Biochemical and immunological investigation of fascioliasis in cattle in Egypt

Research (Published online: 18-05-2020)

14. Biochemical and immunological investigation of fascioliasis in cattle in Egypt

Nani Nasreldin and Rania Samir Zaki

Veterinary World, 13(5): 923-930

ABSTRACT

Background and Aim: Fasciola hepatica and Fasciola gigantica are two commonly reported liver flukes that cause fascioliasis in ruminants. Among the members of the genus Fasciola, F. hepatica was identified in the study area. Fascioliasis is a major disease that affects the production of livestock by causing liver damage. F. hepatica has developed advanced mechanisms to trick, elude, and alter the host immune response, similar to an extrinsic stressor. These mechanisms consequently affect the animals' physiological and metabolic functions in vivo and postmortem changes, which have significant influences on animal welfare and meat quality development. Therefore, this study aimed to determine the current prevalence of cattle fascioliasis at abattoirs in El-Kharga city, New Valley Governorate, Egypt, and to investigate the changes in serum biochemical and immunological parameters and oxidative stress factors due to Fasciola spp. infection in terms of meat quality and immune response.

Materials and Methods: A total of 226 cattle were inspected for the presence of Fasciola spp. The liver of each cattle was examined by making several incisions for detecting adult Fasciola spp. in El- Kharga . The blood samples were collected to analyze the changes in serum biochemical and immunological parameters and oxidative stress factors.

Results: Of the 226 cattle, 38 (16.81%) were positive for F. hepatica at the postmortem examination. Cattle infected with F. hepatica had highly elevated serum alanine aminotransferase, aspartate aminotransferase, glutamate dehydrogenase, γ-glutamyl transferase, urea, and creatinine levels. Immunological cytokine profiles showed significantly increased serum interleukin (IL)-4, IL-10, and transforming growth factor-beta levels and a significantly decreased interferon-γ level. Furthermore, oxidative stress profiles showed significantly increased serum malondialdehyde and nitric oxide levels and significantly decreased total antioxidant capacity and reduced glutathione level.

Conclusion: This study demonstrated that F. hepatica infection alone is an oxidative stress factor that affects slaughtered animals, leading to biochemical and metabolic alterations in the early postmortem period.

Keywords: cattle, Fasciola hepatica, fascioliasis, immune and biochemical response, liver damage.

Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China

Research (Published online: 18-05-2020)

13. Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China

Qiao Mengfan, Wang Lixia, Lei Ying, Ren Yan, Cai Kuojun, Zhang Jinsheng, Zhang Zaichao, Yu Weiwei, Peng Yelong, Cai Xuepeng, Li Chongyang, Qiao Jun and Meng Qingling

Veterinary World, 13(5): 916-922

ABSTRACT

Background and Aim: As a tick-borne zoonotic pathogen, Ehrlichia canis has already posed a threat to public health and safety. This study aimed to clarify the prevalence and molecular characteristics of E. canis in pet dogs in Xinjiang, China.

Materials and Methods: A total of 297 blood samples of pet dogs and 709 skin ticks (Rhipicephalus sanguineus sensu lato) were subjected to molecular detection using PCR for E. canis 16S rRNA gene, and then, positive samples were amplified, sequenced, and phylogenetically analyzed for E. canis gp36 gene.

Results: The PCR detection showed that the positive rate of PCR was 12.12% (36/297) in blood samples and 15.23% (108/709) in tick samples, respectively. Based on the phylogenetic analysis of E. canis gp36 protein, these E. canis strains in different geographical regions of the world can be divided into Genogroup I and Genogroup II. Among them, the Xinjiang epidemic strain XJ-6 and 533, 36, 1055, Kasur1, and Jake strains were clustered into subgroup 1.1 of Genogroup I, while the XJ-2, XJ-21, and XJ-35 strains and the TWN1, TWN4, CM180, and CM196 strains were closely related and belonged to subgroup 2.2 of Genogroup II, displaying high genetic diversity.

Conclusion: This is the first study focusing on the molecular epidemiology of E. canis infection in pet dogs, which revealed that E. canis infection had been occurred in Xinjiang, China. More importantly, this study confirmed that the substantial variability in immunoreactive protein gp36 from E. canis strains circulating in pet dogs.

Keywords: Ehrlichia canis, genetic characteristics, gp36, pet dog, Rhipicephalus sanguineus sensu lato.

Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand

Research (Published online: 16-05-2020)

12. Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand

Jutamas Wongwigkan and Tawin Inpankaew

Veterinary World, 13(5): 909-915

ABSTRACT

Background and Aim: Hookworms are parasitic nematodes that live in the small intestine of their mammalian hosts including humans, dogs, and cats. This study was conducted to determine the prevalence and perform genetic characterization of hookworms using molecular techniques and to elucidate the risk factors associated with hookworm infections among semi-domesticated dogs residing in temples in the Bangkok Metropolitan Area, Thailand.

Materials and Methods: A total of 500 fecal samples were collected from semi-domesticated dogs from 91 temples in 48 districts of Bangkok. DNA was extracted and screened using internal transcribed spacer polymerase chain reaction-restriction fragment length polymorphism. In addition, samples positive for Ancylostoma ceylanicum were further characterized at the haplotype level based on the analysis of the mitochondrial cytochrome oxidase-1 gene (cox1).

Results: The prevalence of hookworm infections in semi-domesticated dogs was 6.2% (31/500). Hookworm infections were detected in temple-community dogs in 12 of 48 districts (25.0%), with Bang Khen and Lak Si districts having the highest proportion of infected dogs (22.6%). Regarding molecular characterization of hookworm species, 21 positive samples (67.74%) were infected with A. ceylanicum and 10 (32.26%) with Ancylostoma caninum. Characterization of cox1 in A. ceylanicum isolates revealed the presence of a mixture of human and dog isolates.

Conclusion: Semi-domesticated dogs act as a potential source of hookworm infections for human and animal populations in Bangkok, Thailand.

Keywords: Bangkok, hookworm, semi-domesticated dogs, Thailand.

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Research (Published online: 15-05-2020)

11. Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

G. Y. Suryawan, I. W. Suardana and I. N. Wandia

Veterinary World, 13(5): 905-908

ABSTRACT

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs.

Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.

Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.

Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.

Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Research (Published online: 15-05-2020)

10. Prevalence of virulence factor, antibiotic resistance, and serotype genes of Pasteurella multocida strains isolated from pigs in Vietnam

Hung Vu-Khac, T. T. Hang Trinh, T. T. Giang Nguyen, X. Truong Nguyen and Thi Thinh Nguyen

Veterinary World, 13(5): 896-904

ABSTRACT

Aim: The study was conducted to determine the prevalence and characterization of the Pasteurella multocida isolates from suspected pigs in Vietnam.

Materials and Methods: A total of 83 P. multocida strains were isolated from lung samples and nasal swabs collected from pigs associated with pneumonia, progressive atrophic rhinitis, or reproductive and respiratory symptoms. Isolates were subjected to multiplex polymerase chain reaction (PCR) for capsular typing, detection of virulence-associated genes and antibiotic resistance genes by PCR. The antimicrobial sensitivity profiles of the isolates were tested by disk diffusion method.

Results: All the isolates 83/83 (100%) were identified as P. multocida by PCR: serogroup A was obtained from 40/83 (48.19%), serogroup D was detected from 24/83 strains (28.91%), and serogroup B was found in 19/83 (22.35%) isolates. The presence of 14 virulence genes was reported including adhesins group (ptfA – 93.97%, pfhA – 93.97%, and fimA – 90.36%), iron acquisition (exbB – 100%, and exbD – 85.54%), hyaluronidase (pmHAS – 84.33%), and protectins (ompA – 56.62%, ompH 68.67%, and oma87 – 100%). The dermonecrotoxin toxA had low prevalence (19.28%). The antimicrobial susceptibility testing revealed that cephalexin, cefotaxime, ceftriaxone, ofloxacin, pefloxacin, ciprofloxacin, and enrofloxacin were the drugs most likely active against P. multocida while amoxicillin and tetracycline were inactive. The usage of PCR revealed that 63/83 isolates were carrying at least one of the drug resistance genes.

Conclusion: Unlike other parts of the word, serotype B was prevalent among Vietnamese porcine P. multocida strains. The high antibiotic resistance detected among these isolates gives us an alert about the current state of imprudent antibiotic usage in controlling the pathogenic bacteria.

Keywords: antibiotic resistance, capsule serotype, Pasteurella multocida, virulence factors.