Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Research (Published online: 20-05-2018)

13. Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms

Lucia S. Triosanti, Michael Haryadi Wibowo and Rini Widayanti

Veterinary World, 11(5): 657-666

ABSTRACT

Background and Aim: Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.

Materials and Methods: The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.

Results: The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.

Conclusion: Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures.

Keywords: hemagglutinin-neuraminidase, Newcastle disease, protein, reverse transcriptase polymerase chain reaction, sequencing, vaccination, virus.

Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Research (Published online: 19-05-2018)

12. Effects of intratesticular injection of zinc-based solution in rats in combination with anti-inflammatory and analgesic drugs during chemical sterilization

Simone Regina Barros de Macedo, Luiz Andre Rodrigues de Lima, Sandra Maria de Torres, Vinicius Vasconcelos Gomes de Oliveira, Rosana Nogueira de Morais, Christina Alves Peixoto, Bruno Mendes Tenorio and Valdemiro Amaro da Silva Junior

Veterinary World, 11(5): 649-656

ABSTRACT

Aim: Chemical sterilization is a non-surgical method of contraception based on compounds injected into the testis to induce infertility. However, these injections can cause discomfort and pain able to impair the recovery of animals after this treatment. The objective of this study was to investigate if anti-inflammatories or pain relievers inhibited the sterilizing effect of zinc gluconate-based solution on the testis.

Materials and Methods: Adult rats were treated in groups: G1 (control), G2 (dimethyl sulfoxide + dipyrone); G3 (dipyrone/ zinc); G4 (dipyrone + celecoxib/zinc); G5 (dipyrone + meloxicam/zinc), and G6 (dipyrone + dexamethasone/zinc) in a single dose per day during 7 days. Animals were analyzed at 7, 15, and 30 days after treatments.

Results: The zinc-induced a widespread testicular degeneration and decreased testosterone levels even in combination with anti-inflammatories or pain relievers. Testis, epididymis, prostate, and seminal vesicle had a weight reduction. The anti-inflammatory effect of dexamethasone interfered in the desired action of zinc gluconate in the 1st 15 days and celecoxib up to 7 days.

Conclusion: Meloxicam plus dipyrone did not impair the chemical sterilization based on zinc gluconate, and it can be used to reduce nociceptive effects in animals after chemical sterilization.

Keywords: analgesic, anti-inflammatory, contraception, testicular degeneration, zinc gluconate.

Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Research (Published online: 18-05-2018)

11. Exploring factors associated with bulk tank milk urea nitrogen in Central Thailand

Suppada Kananub, Wassana Jawjaroensri, John VanLeeuwen, Henrik Stryhn and Pipat Arunvipas

Veterinary World, 11(5): 642-648

ABSTRACT

Aim: The study was to determine seasonal fluctuations and non-nutritional factors associated with bulk tank milk urea nitrogen (BTMUN).

Materials and Methods: A total of 58,364 BTM testing records were collected from 2364 farms in Central Thailand during September 2014-August 2015. Using square root BTMUN as the outcome, other milk components, farm effect, and sampling time were analyzed by univariable repeated measures linear regression, and significant variables were included in multivariable repeated measures linear regression.

Results: The average BTMUN (standard deviation) was 4.71 (±1.16) mmol/L. In the final model, BTM fat and protein percentages were associated with BTMUN as quadratic and cubic polynomials, respectively. BTM lactose percentage and the natural logarithm of somatic cell counts were negatively linearly associated with BTMUN. At the farm level, the BTM lactose association was negatively linear; herd BTMUN decreased following an increase of herd lactose average, and BTM lactose slopes were quite different among farms as well. Sampling time had the highest potency for the estimation of BTMUN over time, with lows and highs occurring in August and October, respectively. The variation in test level BTMUN was decreased by 18.6% compared to the null model, and 6% of the variance could be explained at the farm level.

Conclusion: The results clarify seasonal variation in BTMUN and the relationships among other BTM constituents and BTMUN, which may be useful for understanding how to manage lactating dairy cattle better to keep BTM constituents within normal ranges.

Keywords: bulk tank milk urea nitrogen, farm level, non-nutritional factor, Thailand.

Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Research (Published online: 17-05-2018)

10. Isolation and identification of Mannheimia haemolytica by culture and polymerase chain reaction from sheep's pulmonary samples in Shiraz, Iran

Mohammad Tabatabaei and Fatemeh Abdollahi

Veterinary World, 11(5): 636-641

ABSTRACT

Background and Aim: Mannheimia haemolytica is a Gram-negative, non-motile, and non-spore-forming rod-shaped coccobacillus bacterium. On blood agar plate, it shows complete hemolysis. This bacterium constitutes a part of normal flora of the upper respiratory system of ruminants. It is considered as the opportunistic pathogen and the main factor of pneumonic pasteurellosis, which has caused a severe economic loss in sheep and cattle industries. Considering the prevalence of the disease in sheep and goat population in the dry and hot regions of the country in general and in Fars province in particular in the form of pneumonia, the purpose of this study was to isolate and identify the bacterium M. haemolytica from the lung tissues of sheep slaughtered in Shiraz abattoir through culturing and polymerase chain reaction (PCR) methods.

Materials and Methods: In this study, a total of 2500 sheep's lungs were evaluated for finding pneumonic effects. Then, 161 infected pneumonic samples of lung tissues were investigated by culture and PCR methods.

Results: After cultivation, purification, and DNA extraction, 38 samples were found positive for M. haemolytica by cultivation and then all the 38 isolates were confirmed by PCR and multiplex PCR (mPCR). Results of this study indicated that culture and PCR are both practical in identification and isolation of this bacterium though culture is more time-consuming. The utilized mPCR has been more successful in the identification of the bacteria since it requires less time and cost.

Conclusion: In this study, PCR as a superior method among other methods of bacteriology for fast examination of infectious diseases and mPCR, which is a valuable tool for identification of M. haemolytica in clinical samples of animals, was used.

Keywords: Mannheimia haemolytica, pneumonia, polymerase chain reaction, sheep, Shiraz.

The crucial roles of inflammatory mediators in inflammation: A review

Review (Published online: 15-05-2018)

9. The crucial roles of inflammatory mediators in inflammation: A review

L. A. Abdulkhaleq, M. A. Assi, Rasedee Abdullah, M. Zamri-Saad, Y. H. Taufiq-Yap, and M. N. M. Hezmee

Veterinary World, 11(5): 627-635

ABSTRACT

The inflammatory response is a crucial aspect of the tissues' responses to deleterious inflammogens. This complex response involves leukocytes cells such as macrophages, neutrophils, and lymphocytes, also known as inflammatory cells. In response to the inflammatory process, these cells release specialized substances which include vasoactive amines and peptides, eicosanoids, proinflammatory cytokines, and acute-phase proteins, which mediate the inflammatory process by preventing further tissue damage and ultimately resulting in healing and restoration of tissue function. This review discusses the role of the inflammatory cells as well as their by-products in the mediation of inflammatory process. A brief insight into the role of natural anti-inflammatory agents is also discussed. The significance of this study is to explore further and understand the potential mechanism of inflammatory processes to take full advantage of vast and advanced anti-inflammatory therapies. This review aimed to reemphasize the importance on the knowledge of inflammatory processes with the addition of newest and current issues pertaining to this phenomenon.

Keywords: chemokines, cytokines, inflammatory mediators, inflammatory response.

Evaluation of wet cupping therapy on the arterial and venous blood parameters in healthy Arabian horses

Research (Published online: 14-05-2018)

8. Evaluation of wet cupping therapy on the arterial and venous blood parameters in healthy Arabian horses

Turke Shawaf, Wael El-Deeb, Jamal Hussen, Mahmoud Hendi and Shahab Al-Bulushi

Veterinary World, 11(5): 620-626

ABSTRACT

Aim: Recently, the complementary therapies such as cupping and acupuncture are being used in veterinary medicine. This research was carried out to determine the effects of wet cupping therapy (Hijama) on the hematological and the biochemical parameters in the healthy Arabian horses for the first time.

Materials and Methods: In this study, seven clinically healthy Arabian horses were randomly selected. Four points on the animal body were selected to perform the cupping therapy. Two points were selected at the back just behind the scapula on the left and right sides; another two points were located in the rump. Cups with 4 oz (125 ml) size with narrow mouths were used. A manual pump (sucking cups) was used to create the negative pressure within the cups during cupping. Arterial and venous blood parameters and serum cortisol concentration were measured before cupping and 3 days and 2, 4, and 8 weeks after cupping.

Results: No significant differences were estimated in most hematological and biochemical parameters after cupping. A significant decrease in the concentration of serum cortisol was observed in 3 and 14 days after cupping.

Conclusion: Cupping induced minor changes on the hematological and biochemical parameters in Arabian horses. This is the first trial on the effects of wet cupping therapy on the different parameters in Arabian horses, which would be useful for further investigations on the role of complementary therapies in horses. Our further studies will include different disease models.

Keywords: biochemical, cortisol, cupping, hematological, horse.

Assessment of the peste des petits ruminants world epizootic situation and estimate its spreading to Russia

Research (Published online: 13-05-2018)

7. Assessment of the peste des petits ruminants world epizootic situation and estimate its spreading to Russia

Fayssal Bouchemla, Valerey Alexandrovich Agoltsov, Olga Mikhailovna Popova and Larisa Pavlovna Padilo

Veterinary World, 11(5): 612-619

ABSTRACT

Aim: This study focuses on the spatial dynamic associated with the spreading of the peste des petits ruminants (PPR) disease for the past decade (from the year 2007 to 2017), assesses the resulting situation in the world, and has an emphasis on Russian advantages been a PPR host.

Materials and Methods: Outbreaks were confirmed and reported officially by the World Organization for Animal Health (enzyme-linked immunosorbent assay and polymerase chain reaction were used). Data contain the account number of infected, dead, and all susceptible animals in focus of infection in the period of 2007-2017. Once conventional statistical population was defined, a model was installed. Geo-information system QuickMAP was used to clear up the map disease, and through the @Risk program, we got our forecasting value of future situations (by Monte Carlo method).

Results: The spatial study of PPR's occurrence and its spread was mapping according to the incidence of cases and outbreaks. Clusters demonstrated risk levels in the world in the period from 2007 to 2017 year. Based on the epizootological analysis, an assessment of PPR risk and the probability movement of infection in Russia from nearby disadvantaged countries had been carried out. A statistically significant impact of the socioeconomic system on the stationarity index was found equal to 0.63. The PPR risk of spreading could not be ignored. Nevertheless, conducting effective large-scale vaccine companies in a complex of antiepizootic activities against PPR could reduce the risk of spread of the disease up to 91.8%.

Conclusion: Despite all mentioned facts above, the PPR probability can only be reduced by coordinating work of border veterinary services, as in disadvantaged as in free from this disease country, that is, what makes an effective and complete eradication of the disease could be quite realistic.

Keywords: forecast, incidence, outbreaks, peste des petit ruminants, risk factors.