Wednesday 20 May 2020

Sperm protein markers for Holstein bull fertility at National Artificial Insemination Centers in Indonesia

Research (Published online: 20-05-2020)
17. Sperm protein markers for Holstein bull fertility at National Artificial Insemination Centers in Indonesia
Zulfi Nur Amrina Rosyada, Mokhamad Fakhrul Ulum, Ligaya I. T. A. Tumbelaka and Bambang Purwantara
Veterinary World, 13(5): 947-955
ABSTRACT
Background and Aim: Holstein cows and heifers are widely bred in Indonesia by artificial insemination (AI) to increase population and milk production. Sperm fertility is modulated by genetic factors, but the analysis of sperm quality is still based on macro- and microscopic characteristics. This study aimed to analyze both sperm quality and proteins of Holstein bulls at different fertility levels.
Materials and Methods: The frozen semen samples were collected from the Indonesia National AI Center. They were classified based on the reproductive efficiency data and were grouped into high fertile (HF) and low fertile (LF). Sperm qualities were evaluated by microscopic evaluation. The Holstein sperm proteins were extracted using phenylmethanesulfonyl fluoride as a protease inhibitor and the benzidine detergent extraction method. Discontinuous sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was conducted to analyze the molecular weights (MWs) of the sperm proteins. The data obtained were analyzed by a t-test using the one-factor bull fertility level, and Spearman's correlation analysis was used to identify the correlation between the sperm microscopic evaluation parameters and protein bands.
Results: The sperm motility post-freeze thawing was not significantly different between the HF and LF (p>0.05). The HF level had a higher percentage of viability, intact plasma membrane integrity, and intact acrosomes than the LF (p<0.05). Five protein bands were found in the SDS-PAGE of sperm proteins of Holstein bulls with different concentrations. Sperm proteins with MWs of 17.51 kDa, 14.87 kDa, 33.71 kDa, and 41.97 kDa were abundant in the Holstein bulls with an HF level, while 55 kDa proteins were abundant in the LF level of Holstein bulls. The sperm of Holstein bulls in the HF level contained proteins of about 33.71 kDa that were not detected in the LF.
Conclusion: The sperm protein with a molecular weight of 33.71 kDa was predicted to be a specific protein biomarker that influences bull fertility. Sperm fertilization abilities were also determined by the sperm proteins, the morphology of sperm acrosomes, and the quality of plasma membranes. This method can be used to select bulls with high fertility to increase the population of Holstein bulls.
Keywords: biomarker, fertility, sperm proteins, bull, Holstein.

Tuesday 19 May 2020

Evaluation of ensiled soy sauce by-product combined with several additives as an animal feed

Research (Published online: 19-05-2020)
16. Evaluation of ensiled soy sauce by-product combined with several additives as an animal feed
Sadarman Sadarman, Muhammad Ridla, Nahrowi Nahrowi, Roni Ridwan and Anuraga Jayanegara
Veterinary World, 13(5): 940-946
ABSTRACT
Aim: The present experiment aimed to evaluate the use of different additives, i.e., lactic acid bacteria (LAB) inoculant, tannin extract, and propionic acid, on the chemical composition, fermentative characteristics, and in vitro ruminal fermentation of soy sauce by-product (SSB) silage.
Materials and Methods: SSB was subjected to seven silage additive treatments: Fresh SSB, ensiled SSB, ensiled SSB+LAB, ensiled SSB+2% acacia tannin, ensiled SSB+2% chestnut tannin, ensiled SSB+0.5% propionic acid, and ensiled SSB+1% acacia tannin+1% chestnut tannin+0.5% propionic acid. Ensiling was performed for 30 days in three replicates, and each replicate was made in duplicate. The samples were evaluated for their chemical composition and silage fermentation characteristics and were tested in an in vitro rumen fermentation system.
Results: In general, the nutrient compositions did not differ among the tested SSBs in response to the different additives used. The addition of tannins, either acacia or chestnut, and propionic acid significantly decreased the pH of the ensiled SSB (p<0.05). The addition of several additives (except LAB) decreased the ammonia concentration in SSB silage (p<0.05). The total volatile fatty acids in the in vitro rumen fermentation profile of the ensiled SSB were not significantly altered by the various additives applied. The addition of some additives, i.e., ensiled SSB+LAB and ensiled SSB+2% acacia tannin, reduced the digestibility values of the SSB (p<0.05). Different silage additives did not significantly affect methane production, although the addition of acacia tannins tended to result in the lowest methane production among treatments.
Conclusion: The use of additives, particularly 2% acacia tannins, can reduce proteolysis in SSB silage.
Keywords: additive, feed, silage, soy sauce, tannins.

In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines

Research (Published online: 19-05-2020)
15. In vitro antiproliferation activity of Typhonium flagelliforme leaves ethanol extract and its combination with canine interferons on several tumor-derived cell lines
Bambang Pontjo Priosoeryanto, Riski Rostantinata, Eva Harlina, Waras Nurcholis, Rachmi Ridho and Lina Noviyanti Sutardi
Veterinary World, 13(5): 931-939
ABSTRACT
Background and Aim: Tumor disorder is one of the degenerative diseases that affected human and animals and recently is tend to increase significantly. The treatment of tumor diseases can be performed through surgical, chemotherapy, radiotherapy, biological substances, and herbs medicine. Typhonium flagelliforme leaves extract known to have an antiproliferation activity, while interferons (IFNs) one of the cytokines that first used as an antiviral agent was also known to have antitumor activity. Nowadays, the treatment of tumors using a traditional way, including the use of herbal substances, becomes popular. Some limitations of the antitumor activity due to resistant development of the cell to some substances were one of the problems on why the treatment of cancer was unsuccessful. This study aimed to elaborate the synergistic effect on the antiproliferation and anti-angiogenesis activities of the combinations between T. flagelliforme leaves ethanol extract and canine natural (natural canine IFN [nCaIFN]) and recombinant (recombinant canine IFN [rCaIFN]) IFNs on tumor-derived cell lines to find the new potential antitumor substances.
Materials and Methods: The extraction of T. flagelliforme leaves was performed using the maceration method and followed by phytochemical screening assays. According to the result of LC50 by the brine shrimp lethality test, the dose used for T. flagelliforme extract was 120 ppm while the dose of IFNs was 102 U/ml. The tumor-derived cell lines (canine squamous cell carcinoma [CSCC], canine mammary gland benign mixed tumor/MCM-IPB-B3, and feline squamous cell carcinoma [FSCC]) and normal rabbit endothelial cells were cultured and maintained on Dulbecco's Modified Eagle's Medium DMEM/Ham-F12 medium supplemented with 10% fetal calf serum, antibiotic, and antifungal. The antiproliferation activity was assayed by calculated the total cell number after treated with the tested substances. The antiangiogenesis assay was performed using in vitro method on rabbit normal endothelial cells and in ovo using chicken chorioallantoic membrane (CAM).
Results: The phytochemical screening test of the T. flagelliforme leaves ethanol extract indicated that the compound consisted of flavonoid, steroid, and tannin. The antiproliferation activity was increased in the combination of substances compared to the single exposure of each substance on all tested tumor-derived cell lines. There was no significantly different on the antiproliferation activity between a combination of T. flagelliforme with nCaIFN or rCaIFN in every single tested cell lines, but the comparison of this activity among the three tumor-derived cell lines seem that the antiproliferation activity is more effective on CSCC cell lines compared to the canine mammary gland benign mixed tumor and FSCC cell lines. A similar pattern of synergistic effect was also detected on the anti-angiogenesis activity in vitro using rabbit endothelial cells as well as in ovo assays. The most effective of the in vitro and in ovo anti-angiogenesis activity was observed on the combination substances between T. flagelliforme extract and rCaIFN compared to other treatments.
Conclusion: There was a synergistic effect on the antiproliferation and antiangiogenesis activities of the combination between T. flagelliforme and canine IFNs (natural and recombinant) and this result could be developed as another alternative on the cancer treatments.
Keywords: antiproliferation, antiangiogenesis, canine interferons, ethanol extract, tumor cell lines, Typhonium flagelliforme.

Monday 18 May 2020

Biochemical and immunological investigation of fascioliasis in cattle in Egypt

Research (Published online: 18-05-2020)
14. Biochemical and immunological investigation of fascioliasis in cattle in Egypt
Nani Nasreldin and Rania Samir Zaki
Veterinary World, 13(5): 923-930
ABSTRACT
Background and Aim: Fasciola hepatica and Fasciola gigantica are two commonly reported liver flukes that cause fascioliasis in ruminants. Among the members of the genus FasciolaF. hepatica was identified in the study area. Fascioliasis is a major disease that affects the production of livestock by causing liver damage. F. hepatica has developed advanced mechanisms to trick, elude, and alter the host immune response, similar to an extrinsic stressor. These mechanisms consequently affect the animals' physiological and metabolic functions in vivo and postmortem changes, which have significant influences on animal welfare and meat quality development. Therefore, this study aimed to determine the current prevalence of cattle fascioliasis at abattoirs in El-Kharga city, New Valley Governorate, Egypt, and to investigate the changes in serum biochemical and immunological parameters and oxidative stress factors due to Fasciola spp. infection in terms of meat quality and immune response.
Materials and Methods: A total of 226 cattle were inspected for the presence of Fasciola spp. The liver of each cattle was examined by making several incisions for detecting adult Fasciola spp. in El- Kharga . The blood samples were collected to analyze the changes in serum biochemical and immunological parameters and oxidative stress factors.
Results: Of the 226 cattle, 38 (16.81%) were positive for F. hepatica at the postmortem examination. Cattle infected with F. hepatica had highly elevated serum alanine aminotransferase, aspartate aminotransferase, glutamate dehydrogenase, γ-glutamyl transferase, urea, and creatinine levels. Immunological cytokine profiles showed significantly increased serum interleukin (IL)-4, IL-10, and transforming growth factor-beta levels and a significantly decreased interferon-γ level. Furthermore, oxidative stress profiles showed significantly increased serum malondialdehyde and nitric oxide levels and significantly decreased total antioxidant capacity and reduced glutathione level.
Conclusion: This study demonstrated that F. hepatica infection alone is an oxidative stress factor that affects slaughtered animals, leading to biochemical and metabolic alterations in the early postmortem period.
Keywords: cattle, Fasciola hepatica, fascioliasis, immune and biochemical response, liver damage.

Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China

Research (Published online: 18-05-2020)
13. Molecular detection and genetic variability of Ehrlichia canis in pet dogs in Xinjiang, China
Qiao Mengfan, Wang Lixia, Lei Ying, Ren Yan, Cai Kuojun, Zhang Jinsheng, Zhang Zaichao, Yu Weiwei, Peng Yelong, Cai Xuepeng, Li Chongyang, Qiao Jun and Meng Qingling
Veterinary World, 13(5): 916-922
ABSTRACT
Background and Aim: As a tick-borne zoonotic pathogen, Ehrlichia canis has already posed a threat to public health and safety. This study aimed to clarify the prevalence and molecular characteristics of E. canis in pet dogs in Xinjiang, China.
Materials and Methods: A total of 297 blood samples of pet dogs and 709 skin ticks (Rhipicephalus sanguineus sensu lato) were subjected to molecular detection using PCR for E. canis 16S rRNA gene, and then, positive samples were amplified, sequenced, and phylogenetically analyzed for E. canis gp36 gene.
Results: The PCR detection showed that the positive rate of PCR was 12.12% (36/297) in blood samples and 15.23% (108/709) in tick samples, respectively. Based on the phylogenetic analysis of E. canis gp36 protein, these E. canis strains in different geographical regions of the world can be divided into Genogroup I and Genogroup II. Among them, the Xinjiang epidemic strain XJ-6 and 533, 36, 1055, Kasur1, and Jake strains were clustered into subgroup 1.1 of Genogroup I, while the XJ-2, XJ-21, and XJ-35 strains and the TWN1, TWN4, CM180, and CM196 strains were closely related and belonged to subgroup 2.2 of Genogroup II, displaying high genetic diversity.
Conclusion: This is the first study focusing on the molecular epidemiology of E. canis infection in pet dogs, which revealed that E. canis infection had been occurred in Xinjiang, China. More importantly, this study confirmed that the substantial variability in immunoreactive protein gp36 from E. canis strains circulating in pet dogs.
Keywords: Ehrlichia canis, genetic characteristics, gp36, pet dog, Rhipicephalus sanguineus sensu lato.

Saturday 16 May 2020

Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand

Research (Published online: 16-05-2020)
12. Semi-domesticated dogs as a potential reservoir for zoonotic hookworms in Bangkok, Thailand
Jutamas Wongwigkan and Tawin Inpankaew
Veterinary World, 13(5): 909-915
ABSTRACT
Background and Aim: Hookworms are parasitic nematodes that live in the small intestine of their mammalian hosts including humans, dogs, and cats. This study was conducted to determine the prevalence and perform genetic characterization of hookworms using molecular techniques and to elucidate the risk factors associated with hookworm infections among semi-domesticated dogs residing in temples in the Bangkok Metropolitan Area, Thailand.
Materials and Methods: A total of 500 fecal samples were collected from semi-domesticated dogs from 91 temples in 48 districts of Bangkok. DNA was extracted and screened using internal transcribed spacer polymerase chain reaction-restriction fragment length polymorphism. In addition, samples positive for Ancylostoma ceylanicum were further characterized at the haplotype level based on the analysis of the mitochondrial cytochrome oxidase-1 gene (cox1).
Results: The prevalence of hookworm infections in semi-domesticated dogs was 6.2% (31/500). Hookworm infections were detected in temple-community dogs in 12 of 48 districts (25.0%), with Bang Khen and Lak Si districts having the highest proportion of infected dogs (22.6%). Regarding molecular characterization of hookworm species, 21 positive samples (67.74%) were infected with A. ceylanicum and 10 (32.26%) with Ancylostoma caninum. Characterization of cox1 in A. ceylanicum isolates revealed the presence of a mixture of human and dog isolates.
Conclusion: Semi-domesticated dogs act as a potential source of hookworm infections for human and animal populations in Bangkok, Thailand.
Keywords: Bangkok, hookworm, semi-domesticated dogs, Thailand.

Friday 15 May 2020

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Research (Published online: 15-05-2020)
11. Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia
G. Y. Suryawan, I. W. Suardana and I. N. Wandia
Veterinary World, 13(5): 905-908
ABSTRACT
Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs.
Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3.
Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs.
Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.
Keywords: beef meatball, food safety, polymerase chain reaction method, public health, rat meat, sensitivity.